Incidental Mutation 'R0578:Akna'
ID56297
Institutional Source Beutler Lab
Gene Symbol Akna
Ensembl Gene ENSMUSG00000039158
Gene NameAT-hook transcription factor
Synonyms
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0578 (G1)
Quality Score85
Status Validated
Chromosome4
Chromosomal Location63367125-63403354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63370910 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1259 (S1259P)
Ref Sequence ENSEMBL: ENSMUSP00000041614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035724]
Predicted Effect probably benign
Transcript: ENSMUST00000035724
AA Change: S1259P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041614
Gene: ENSMUSG00000039158
AA Change: S1259P

DomainStartEndE-ValueType
low complexity region 140 153 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
Pfam:AKNA 584 681 4.6e-37 PFAM
low complexity region 760 774 N/A INTRINSIC
low complexity region 1015 1029 N/A INTRINSIC
coiled coil region 1044 1066 N/A INTRINSIC
low complexity region 1296 1317 N/A INTRINSIC
low complexity region 1319 1343 N/A INTRINSIC
coiled coil region 1353 1386 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic or a knock-out allele exhibit partial postnatal lethality, pathogen-induced acute neutrophil responses leading to systemic inflammation and alveolar destruction, and increased susceptibility to fungal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Akna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Akna APN 4 63397873 critical splice donor site probably null
IGL00590:Akna APN 4 63371878 missense probably benign 0.00
IGL01567:Akna APN 4 63381850 missense probably benign
IGL01667:Akna APN 4 63379159 missense probably benign 0.34
IGL01820:Akna APN 4 63386258 missense probably benign 0.30
IGL01956:Akna APN 4 63379290 missense probably benign 0.04
IGL02148:Akna APN 4 63382479 splice site probably benign
IGL02502:Akna APN 4 63368203 missense probably benign 0.28
IGL02674:Akna APN 4 63370944 nonsense probably null
IGL02792:Akna APN 4 63377706 missense possibly damaging 0.73
IGL02956:Akna APN 4 63386279 missense probably benign 0.05
R0035:Akna UTSW 4 63382445 missense probably benign 0.16
R0049:Akna UTSW 4 63394635 missense probably damaging 0.97
R0133:Akna UTSW 4 63379361 nonsense probably null
R0396:Akna UTSW 4 63392126 splice site probably benign
R0422:Akna UTSW 4 63392154 missense probably damaging 1.00
R0784:Akna UTSW 4 63376888 missense probably benign
R1264:Akna UTSW 4 63381725 splice site probably null
R1539:Akna UTSW 4 63379310 missense probably benign 0.00
R1575:Akna UTSW 4 63379333 missense probably benign 0.01
R1646:Akna UTSW 4 63383892 missense probably benign
R2115:Akna UTSW 4 63395160 missense probably benign 0.01
R2121:Akna UTSW 4 63376900 missense probably benign 0.08
R2324:Akna UTSW 4 63371802 missense possibly damaging 0.92
R2961:Akna UTSW 4 63394944 missense probably benign 0.04
R3150:Akna UTSW 4 63395353 missense possibly damaging 0.80
R3552:Akna UTSW 4 63398124 start codon destroyed probably null 0.53
R3855:Akna UTSW 4 63373468 missense probably damaging 0.98
R4023:Akna UTSW 4 63374390 missense probably benign
R4247:Akna UTSW 4 63395172 missense probably benign 0.00
R4299:Akna UTSW 4 63398032 missense possibly damaging 0.59
R4422:Akna UTSW 4 63387093 missense possibly damaging 0.86
R4499:Akna UTSW 4 63395041 missense probably benign
R4723:Akna UTSW 4 63387032 missense probably benign
R4743:Akna UTSW 4 63378613 missense probably damaging 1.00
R4780:Akna UTSW 4 63379254 missense probably benign
R4903:Akna UTSW 4 63374037 missense probably damaging 1.00
R4936:Akna UTSW 4 63395265 missense probably damaging 0.97
R5041:Akna UTSW 4 63387144 missense possibly damaging 0.67
R5276:Akna UTSW 4 63368203 missense possibly damaging 0.95
R5297:Akna UTSW 4 63381846 missense possibly damaging 0.93
R5546:Akna UTSW 4 63394959 missense probably benign 0.15
R5546:Akna UTSW 4 63395566 missense probably benign
R5773:Akna UTSW 4 63395070 missense probably benign 0.41
R5966:Akna UTSW 4 63394903 missense probably damaging 0.99
R6127:Akna UTSW 4 63368119 missense possibly damaging 0.67
R6176:Akna UTSW 4 63377732 missense probably benign 0.04
R6337:Akna UTSW 4 63374003 missense probably benign 0.00
R6701:Akna UTSW 4 63395280 missense probably benign
R6800:Akna UTSW 4 63398031 missense probably benign
R6931:Akna UTSW 4 63387102 missense probably benign 0.02
R7451:Akna UTSW 4 63378667 missense probably benign 0.16
R7644:Akna UTSW 4 63395397 missense possibly damaging 0.48
R7786:Akna UTSW 4 63394962 missense probably benign
RF048:Akna UTSW 4 63377841 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGACTTAGATGCAGCCAAGCAC -3'
(R):5'- AAGCAAGTCTGATGCTCAGGCAG -3'

Sequencing Primer
(F):5'- CCTGCACTTGTGGCTGATG -3'
(R):5'- TACACTGAGGCTGTCTCAAAG -3'
Posted On2013-07-11