Incidental Mutation 'R7238:Ptpn6'
ID562979
Institutional Source Beutler Lab
Gene Symbol Ptpn6
Ensembl Gene ENSMUSG00000004266
Gene Nameprotein tyrosine phosphatase, non-receptor type 6
SynonymsHcph, hcp, SHP-1, Ptp1C
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R7238 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124720707-124738714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124721858 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 498 (S498P)
Ref Sequence ENSEMBL: ENSMUSP00000004377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004375] [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000174265] [ENSMUST00000174787]
Predicted Effect probably benign
Transcript: ENSMUST00000004375
SMART Domains Protein: ENSMUSP00000004375
Gene: ENSMUSG00000004264

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
PHB 39 201 1.01e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000004377
AA Change: S498P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: S498P

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112484
AA Change: S496P

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: S496P

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171549
AA Change: S498P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: S498P

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172690
Predicted Effect probably benign
Transcript: ENSMUST00000173315
SMART Domains Protein: ENSMUSP00000134274
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SCOP:d1eeoa_ 2 38 1e-3 SMART
PDB:3PS5|A 2 91 2e-41 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000174265
AA Change: S457P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: S457P

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174787
Meta Mutation Damage Score 0.4261 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,069,951 T1634S probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Col6a4 C T 9: 106,000,320 V2153M probably damaging Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Immp2l T C 12: 41,110,916 V71A possibly damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Lrrc73 G A 17: 46,254,562 R73H probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mx1 A G 16: 97,448,296 I347T unknown Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Olfr385 A T 11: 73,589,735 M1K probably null Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Selenoo T A 15: 89,089,224 M39K probably benign Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in Ptpn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 splice site probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
caterpillar UTSW 6 124724984 missense probably benign
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
Flutterby UTSW 6 124721858 missense possibly damaging 0.89
Lepidopteran UTSW 6 124728172 missense probably damaging 1.00
Malachite UTSW 6 124728651 missense possibly damaging 0.84
Naphthalene UTSW 6 124721789 missense probably benign 0.42
spin UTSW 6 124728559 missense probably damaging 1.00
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
R6374:Ptpn6 UTSW 6 124732569 splice site probably null
R7381:Ptpn6 UTSW 6 124728172 missense probably damaging 1.00
R7935:Ptpn6 UTSW 6 124732462 missense possibly damaging 0.93
R8297:Ptpn6 UTSW 6 124728651 missense possibly damaging 0.84
Z1176:Ptpn6 UTSW 6 124725076 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGATATTCCCATACTCCGAC -3'
(R):5'- TGGAAAGCATCTCCACCAAG -3'

Sequencing Primer
(F):5'- CTTCTGGGACTGTGGGCAAAG -3'
(R):5'- ACCAAGGGTGAGGAGCCC -3'
Posted On2019-06-26