Mutagenetix > Incidental Mutations

Incidental Mutation 'R7238:Grin2b'

562982

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7238 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135780251 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 404 (D404G)

Ref Sequence

ENSEMBL: ENSMUSP00000062284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: D404G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: D404G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: D404G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: D404G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Meta Mutation Damage Score

0.1702

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

97% (104/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,069,951	T1634S	probably damaging	Het
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
4933402N22Rik	T	C	5: 11,920,745	I127T		Het
5830473C10Rik	A	T	5: 90,579,660	Y379F	probably damaging	Het
Adgrl1	T	A	8: 83,939,064	M1460K	probably damaging	Het
Adig	T	A	2: 158,505,853	L29Q	unknown	Het
Adnp	T	G	2: 168,183,967	K469N	probably damaging	Het
Akap3	A	G	6: 126,865,237	D273G	probably benign	Het
Ankrd34b	T	C	13: 92,438,631	Y124H	possibly damaging	Het
Ap2b1	T	G	11: 83,333,122	F221C	possibly damaging	Het
Atp2c2	A	G	8: 119,742,421	I358V	possibly damaging	Het
BC051665	G	A	13: 60,782,722	T272I	probably benign	Het
BC117090	C	T	16: 36,321,831	G61D	probably benign	Het
Cdan1	G	T	2: 120,730,302	A262E	probably benign	Het
Ces1d	C	T	8: 93,178,135	V326I	probably benign	Het
Chd3	T	C	11: 69,364,047	R156G	probably benign	Het
Clip1	C	T	5: 123,613,265	E818K		Het
Col6a4	C	T	9: 106,000,320	V2153M	probably damaging	Het
Crlf3	T	C	11: 80,056,525	N296D	possibly damaging	Het
D130052B06Rik	A	G	11: 33,623,594	I109V	probably benign	Het
Dcaf5	G	T	12: 80,338,709	T881K	probably benign	Het
Dennd4a	C	A	9: 64,861,956	T408K	probably damaging	Het
Dnah2	A	G	11: 69,459,146		probably null	Het
Eif2ak2	C	T	17: 78,866,331	V273I	probably benign	Het
Elac1	C	T	18: 73,739,288	G212D	probably damaging	Het
Ercc6l2	A	G	13: 63,865,984	D623G	probably damaging	Het
Exo1	T	C	1: 175,888,847	F177L	probably damaging	Het
Fat4	A	G	3: 38,890,413	T1152A	probably benign	Het
Fbxl12	G	T	9: 20,618,413		probably null	Het
Fbxo43	T	C	15: 36,151,825	Y582C	probably damaging	Het
Fsip2	T	A	2: 82,982,140	N2934K	possibly damaging	Het
Gm4951	A	G	18: 60,246,283	S297G	possibly damaging	Het
Gm8300	A	T	12: 87,517,236	K114*	probably null	Het
Gna12	A	G	5: 140,830,092	S69P	probably damaging	Het
Gpatch8	C	A	11: 102,478,528	G1395C	probably damaging	Het
Gpr137c	A	G	14: 45,278,691	Y294C	probably damaging	Het
Greb1	A	G	12: 16,674,672	S1834P	probably damaging	Het
Hectd2	A	T	19: 36,597,078	N236I	probably damaging	Het
Hhip	C	T	8: 79,987,012	V562I	probably benign	Het
Hipk2	G	T	6: 38,716,057	T867N	probably benign	Het
Hmgcl	T	C	4: 135,962,113	V294A	possibly damaging	Het
Hnrnpl	T	A	7: 28,813,975	F158I		Het
Hspa5	T	C	2: 34,772,371	V17A	unknown	Het
Hspg2	T	C	4: 137,508,393	V168A	probably damaging	Het
Idh1	A	G	1: 65,166,125	F227S	probably damaging	Het
Immp2l	T	C	12: 41,110,916	V71A	possibly damaging	Het
Iqce	G	A	5: 140,689,958	R193*	probably null	Het
Kcnq5	T	C	1: 21,402,302	D907G	probably benign	Het
Krt17	T	A	11: 100,257,787	T306S	probably benign	Het
Lhx3	T	C	2: 26,202,997	D149G	probably damaging	Het
Lrrc73	G	A	17: 46,254,562	R73H	probably damaging	Het
Mgat5b	T	C	11: 116,984,983	S678P	probably benign	Het
Mink1	T	C	11: 70,611,479		probably null	Het
Mroh5	T	G	15: 73,791,429		probably null	Het
Muc5ac	T	A	7: 141,809,517	H2188Q	unknown	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Musk	G	A	4: 58,344,312	G305D	probably benign	Het
Mx1	A	G	16: 97,448,296	I347T	unknown	Het
Mybbp1a	G	T	11: 72,443,512	V198F	probably damaging	Het
Mycbp2	A	G	14: 103,156,297	S2943P	probably damaging	Het
Myo18a	G	A	11: 77,842,233	R1363K	probably damaging	Het
Nav3	T	A	10: 109,853,324	D364V	possibly damaging	Het
Olfr127	T	C	17: 37,904,437	L297S	probably benign	Het
Olfr178	T	A	16: 58,889,889	E110D	probably damaging	Het
Olfr309	T	C	7: 86,306,591	H174R	probably damaging	Het
Olfr341	T	A	2: 36,479,714	N139Y	possibly damaging	Het
Olfr385	A	T	11: 73,589,735	M1K	probably null	Het
Pecr	T	C	1: 72,259,433	D276G	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Ppp1cb	A	T	5: 32,491,032	T320S	probably benign	Het
Ppp1r9a	G	T	6: 5,159,716	K1084N	probably damaging	Het
Prdm2	A	G	4: 143,135,821	S300P	probably benign	Het
Prkg1	C	T	19: 30,624,690	V389I	probably damaging	Het
Psg25	C	T	7: 18,532,202		probably benign	Het
Ptpn6	A	G	6: 124,721,858	S498P	possibly damaging	Het
Pus3	A	G	9: 35,566,669	H399R	probably benign	Het
Pus7	T	C	5: 23,778,452	T6A	probably benign	Het
Rnf169	A	G	7: 99,925,747	V547A	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,921		probably benign	Het
Ryr1	C	T	7: 29,095,382	D1194N	probably benign	Het
Scn5a	T	C	9: 119,491,544	M1490V	possibly damaging	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Selenoo	T	A	15: 89,089,224	M39K	probably benign	Het
Sept8	T	G	11: 53,536,692	V246G	possibly damaging	Het
Serpina3k	T	A	12: 104,343,108	N270K	probably damaging	Het
Setd5	G	A	6: 113,121,130	R710H	probably damaging	Het
Sirt4	A	T	5: 115,482,990	I41N	possibly damaging	Het
Slc26a9	T	A	1: 131,758,818	Y425*	probably null	Het
Slc4a9	A	G	18: 36,529,720	E176G	probably benign	Het
Spidr	A	T	16: 15,966,816	W463R	probably benign	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmcc1	G	A	6: 116,134,237	Q28*	probably null	Het
Tmem52b	A	G	6: 129,516,688	E88G	probably damaging	Het
Trpc7	A	T	13: 56,826,897	I402K	probably benign	Het
Tshz3	T	C	7: 36,770,097	Y504H	probably damaging	Het
Ttn	T	C	2: 76,712,205	E33479G	possibly damaging	Het
Ttn	G	A	2: 76,881,328	R8290C	unknown	Het
Urb1	T	C	16: 90,752,115	D2235G	possibly damaging	Het
Usp10	T	C	8: 119,941,544	F195L	probably benign	Het
Vmn1r31	A	T	6: 58,472,873	F2L		Het
Vmn2r109	C	T	17: 20,541,074	V674M	probably damaging	Het
Vmn2r12	G	A	5: 109,097,789	P26S	possibly damaging	Het
Vmn2r61	T	A	7: 42,267,205	M414K	possibly damaging	Het
Yipf3	T	C	17: 46,251,659	V330A	probably benign	Het
Zic4	A	T	9: 91,379,397	H235L	probably benign	Het
Zxdc	T	A	6: 90,369,660	W16R	unknown	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCAGAGGGTGCCTAGCTC -3'
(R):5'- GAATTGTTTTGCCCTTGCTTAACAG -3'

Sequencing Primer
(F):5'- TGCCTAGCTCCAGGTCAAC -3'
(R):5'- GCTTCTAAGACAATTCAGAGAGGACC -3'

Posted On

2019-06-26