Mutagenetix > Incidental Mutation

Incidental Mutation 'R7238:Ryr1'

562985

Institutional Source

Beutler Lab

Gene Symbol

Ryr1

Ensembl Gene

ENSMUSG00000030592

Gene Name

ryanodine receptor 1, skeletal muscle

Synonyms

skrr, calcium release channel isoform 1, Ryr

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7238 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29003344-29125179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 29095382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1194 (D1194N)

Ref Sequence

ENSEMBL: ENSMUSP00000149042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032813
AA Change: D1187N

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: D1187N

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	441	645	1.2e-73	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	851	945	6.5e-33	PFAM
Pfam:RyR	965	1059	1.5e-30	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2158	2366	7e-66	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2735	2829	9.7e-34	PFAM
Pfam:RyR	2855	2943	5.7e-32	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3613	3642	2e-13	PDB
low complexity region	3681	3691	N/A	INTRINSIC
low complexity region	3735	3760	N/A	INTRINSIC
Pfam:RIH_assoc	3872	4004	1.9e-41	PFAM
low complexity region	4010	4023	N/A	INTRINSIC
Pfam:EF-hand_8	4085	4136	9.8e-8	PFAM
transmembrane domain	4283	4305	N/A	INTRINSIC
transmembrane domain	4318	4336	N/A	INTRINSIC
transmembrane domain	4341	4363	N/A	INTRINSIC
Pfam:RR_TM4-6	4377	4666	2e-86	PFAM
Pfam:Ion_trans	4761	4932	3.4e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179893
AA Change: D1187N

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: D1187N

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	443	638	4.5e-63	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	852	942	1.3e-37	PFAM
Pfam:RyR	966	1056	1.6e-28	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2160	2366	2.2e-68	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2736	2826	7.2e-31	PFAM
Pfam:RyR	2856	2940	5.6e-27	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3615	3644	2e-13	PDB
low complexity region	3683	3693	N/A	INTRINSIC
low complexity region	3737	3762	N/A	INTRINSIC
Pfam:RIH_assoc	3878	3996	6.2e-35	PFAM
low complexity region	4012	4025	N/A	INTRINSIC
Pfam:EF-hand_8	4087	4137	1.8e-8	PFAM
transmembrane domain	4285	4307	N/A	INTRINSIC
transmembrane domain	4320	4338	N/A	INTRINSIC
transmembrane domain	4343	4365	N/A	INTRINSIC
Pfam:RR_TM4-6	4379	4668	8.4e-76	PFAM
Pfam:Ion_trans	4763	4946	2.8e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214374
AA Change: D1194N

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

97% (104/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,069,951	T1634S	probably damaging	Het
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
4933402N22Rik	T	C	5: 11,920,745	I127T		Het
5830473C10Rik	A	T	5: 90,579,660	Y379F	probably damaging	Het
Adgrl1	T	A	8: 83,939,064	M1460K	probably damaging	Het
Adig	T	A	2: 158,505,853	L29Q	unknown	Het
Adnp	T	G	2: 168,183,967	K469N	probably damaging	Het
Akap3	A	G	6: 126,865,237	D273G	probably benign	Het
Ankrd34b	T	C	13: 92,438,631	Y124H	possibly damaging	Het
Ap2b1	T	G	11: 83,333,122	F221C	possibly damaging	Het
Atp2c2	A	G	8: 119,742,421	I358V	possibly damaging	Het
BC051665	G	A	13: 60,782,722	T272I	probably benign	Het
BC117090	C	T	16: 36,321,831	G61D	probably benign	Het
Cdan1	G	T	2: 120,730,302	A262E	probably benign	Het
Ces1d	C	T	8: 93,178,135	V326I	probably benign	Het
Chd3	T	C	11: 69,364,047	R156G	probably benign	Het
Clip1	C	T	5: 123,613,265	E818K		Het
Col6a4	C	T	9: 106,000,320	V2153M	probably damaging	Het
Crlf3	T	C	11: 80,056,525	N296D	possibly damaging	Het
D130052B06Rik	A	G	11: 33,623,594	I109V	probably benign	Het
Dcaf5	G	T	12: 80,338,709	T881K	probably benign	Het
Dennd4a	C	A	9: 64,861,956	T408K	probably damaging	Het
Dnah2	A	G	11: 69,459,146		probably null	Het
Eif2ak2	C	T	17: 78,866,331	V273I	probably benign	Het
Elac1	C	T	18: 73,739,288	G212D	probably damaging	Het
Ercc6l2	A	G	13: 63,865,984	D623G	probably damaging	Het
Exo1	T	C	1: 175,888,847	F177L	probably damaging	Het
Fat4	A	G	3: 38,890,413	T1152A	probably benign	Het
Fbxl12	G	T	9: 20,618,413		probably null	Het
Fbxo43	T	C	15: 36,151,825	Y582C	probably damaging	Het
Fsip2	T	A	2: 82,982,140	N2934K	possibly damaging	Het
Gm4951	A	G	18: 60,246,283	S297G	possibly damaging	Het
Gm8300	A	T	12: 87,517,236	K114*	probably null	Het
Gna12	A	G	5: 140,830,092	S69P	probably damaging	Het
Gpatch8	C	A	11: 102,478,528	G1395C	probably damaging	Het
Gpr137c	A	G	14: 45,278,691	Y294C	probably damaging	Het
Greb1	A	G	12: 16,674,672	S1834P	probably damaging	Het
Grin2b	T	C	6: 135,780,251	D404G	probably damaging	Het
Hectd2	A	T	19: 36,597,078	N236I	probably damaging	Het
Hhip	C	T	8: 79,987,012	V562I	probably benign	Het
Hipk2	G	T	6: 38,716,057	T867N	probably benign	Het
Hmgcl	T	C	4: 135,962,113	V294A	possibly damaging	Het
Hnrnpl	T	A	7: 28,813,975	F158I		Het
Hspa5	T	C	2: 34,772,371	V17A	unknown	Het
Hspg2	T	C	4: 137,508,393	V168A	probably damaging	Het
Idh1	A	G	1: 65,166,125	F227S	probably damaging	Het
Immp2l	T	C	12: 41,110,916	V71A	possibly damaging	Het
Iqce	G	A	5: 140,689,958	R193*	probably null	Het
Kcnq5	T	C	1: 21,402,302	D907G	probably benign	Het
Krt17	T	A	11: 100,257,787	T306S	probably benign	Het
Lhx3	T	C	2: 26,202,997	D149G	probably damaging	Het
Lrrc73	G	A	17: 46,254,562	R73H	probably damaging	Het
Mgat5b	T	C	11: 116,984,983	S678P	probably benign	Het
Mink1	T	C	11: 70,611,479		probably null	Het
Mroh5	T	G	15: 73,791,429		probably null	Het
Muc5ac	T	A	7: 141,809,517	H2188Q	unknown	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Musk	G	A	4: 58,344,312	G305D	probably benign	Het
Mx1	A	G	16: 97,448,296	I347T	unknown	Het
Mybbp1a	G	T	11: 72,443,512	V198F	probably damaging	Het
Mycbp2	A	G	14: 103,156,297	S2943P	probably damaging	Het
Myo18a	G	A	11: 77,842,233	R1363K	probably damaging	Het
Nav3	T	A	10: 109,853,324	D364V	possibly damaging	Het
Olfr127	T	C	17: 37,904,437	L297S	probably benign	Het
Olfr178	T	A	16: 58,889,889	E110D	probably damaging	Het
Olfr309	T	C	7: 86,306,591	H174R	probably damaging	Het
Olfr341	T	A	2: 36,479,714	N139Y	possibly damaging	Het
Olfr385	A	T	11: 73,589,735	M1K	probably null	Het
Pecr	T	C	1: 72,259,433	D276G	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Ppp1cb	A	T	5: 32,491,032	T320S	probably benign	Het
Ppp1r9a	G	T	6: 5,159,716	K1084N	probably damaging	Het
Prdm2	A	G	4: 143,135,821	S300P	probably benign	Het
Prkg1	C	T	19: 30,624,690	V389I	probably damaging	Het
Psg25	C	T	7: 18,532,202		probably benign	Het
Ptpn6	A	G	6: 124,721,858	S498P	possibly damaging	Het
Pus3	A	G	9: 35,566,669	H399R	probably benign	Het
Pus7	T	C	5: 23,778,452	T6A	probably benign	Het
Rnf169	A	G	7: 99,925,747	V547A	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,921		probably benign	Het
Scn5a	T	C	9: 119,491,544	M1490V	possibly damaging	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Selenoo	T	A	15: 89,089,224	M39K	probably benign	Het
Sept8	T	G	11: 53,536,692	V246G	possibly damaging	Het
Serpina3k	T	A	12: 104,343,108	N270K	probably damaging	Het
Setd5	G	A	6: 113,121,130	R710H	probably damaging	Het
Sirt4	A	T	5: 115,482,990	I41N	possibly damaging	Het
Slc26a9	T	A	1: 131,758,818	Y425*	probably null	Het
Slc4a9	A	G	18: 36,529,720	E176G	probably benign	Het
Spidr	A	T	16: 15,966,816	W463R	probably benign	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmcc1	G	A	6: 116,134,237	Q28*	probably null	Het
Tmem52b	A	G	6: 129,516,688	E88G	probably damaging	Het
Trpc7	A	T	13: 56,826,897	I402K	probably benign	Het
Tshz3	T	C	7: 36,770,097	Y504H	probably damaging	Het
Ttn	T	C	2: 76,712,205	E33479G	possibly damaging	Het
Ttn	G	A	2: 76,881,328	R8290C	unknown	Het
Urb1	T	C	16: 90,752,115	D2235G	possibly damaging	Het
Usp10	T	C	8: 119,941,544	F195L	probably benign	Het
Vmn1r31	A	T	6: 58,472,873	F2L		Het
Vmn2r109	C	T	17: 20,541,074	V674M	probably damaging	Het
Vmn2r12	G	A	5: 109,097,789	P26S	possibly damaging	Het
Vmn2r61	T	A	7: 42,267,205	M414K	possibly damaging	Het
Yipf3	T	C	17: 46,251,659	V330A	probably benign	Het
Zic4	A	T	9: 91,379,397	H235L	probably benign	Het
Zxdc	T	A	6: 90,369,660	W16R	unknown	Het

Other mutations in Ryr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ryr1	APN	7	29102810	missense	probably damaging	1.00
IGL00335:Ryr1	APN	7	29124960	splice site	probably null
IGL00427:Ryr1	APN	7	29104737	splice site	probably benign
IGL00559:Ryr1	APN	7	29012242	splice site	probably benign
IGL00803:Ryr1	APN	7	29069645	missense	possibly damaging	0.95
IGL00886:Ryr1	APN	7	29024229	missense	probably damaging	1.00
IGL00948:Ryr1	APN	7	29020195	missense	possibly damaging	0.78
IGL01017:Ryr1	APN	7	29082543	missense	probably damaging	0.99
IGL01116:Ryr1	APN	7	29100202	splice site	probably benign
IGL01385:Ryr1	APN	7	29056985	missense	probably damaging	1.00
IGL01482:Ryr1	APN	7	29052337	missense	probably damaging	1.00
IGL01529:Ryr1	APN	7	29075227	missense	probably damaging	1.00
IGL01543:Ryr1	APN	7	29091076	missense	probably damaging	1.00
IGL01653:Ryr1	APN	7	29078597	missense	probably damaging	0.99
IGL01701:Ryr1	APN	7	29059810	missense	probably damaging	0.98
IGL02051:Ryr1	APN	7	29071658	missense	probably benign	0.16
IGL02152:Ryr1	APN	7	29052015	missense	possibly damaging	0.95
IGL02271:Ryr1	APN	7	29094047	missense	probably benign	0.07
IGL02321:Ryr1	APN	7	29078696	missense	probably damaging	1.00
IGL02448:Ryr1	APN	7	29105066	splice site	probably benign
IGL02472:Ryr1	APN	7	29040844	missense	probably damaging	1.00
IGL02544:Ryr1	APN	7	29115599	missense	probably benign	0.24
IGL02666:Ryr1	APN	7	29019763	missense	unknown
IGL02672:Ryr1	APN	7	29004519	unclassified	probably benign
IGL02677:Ryr1	APN	7	29110608	missense	probably benign	0.18
IGL02686:Ryr1	APN	7	29069550	splice site	probably benign
IGL02751:Ryr1	APN	7	29078774	missense	probably damaging	1.00
IGL02899:Ryr1	APN	7	29048795	missense	possibly damaging	0.53
IGL02926:Ryr1	APN	7	29061540	missense	probably damaging	1.00
IGL02950:Ryr1	APN	7	29097459	missense	probably damaging	1.00
IGL02960:Ryr1	APN	7	29060053	missense	probably damaging	1.00
IGL02968:Ryr1	APN	7	29043893	missense	probably damaging	1.00
IGL03070:Ryr1	APN	7	29070659	missense	probably damaging	1.00
IGL03091:Ryr1	APN	7	29083486	missense	possibly damaging	0.85
IGL03100:Ryr1	APN	7	29104593	missense	probably damaging	1.00
IGL03107:Ryr1	APN	7	29075199	missense	probably damaging	1.00
IGL03117:Ryr1	APN	7	29102964	missense	probably damaging	1.00
IGL03118:Ryr1	APN	7	29015786	missense	unknown
IGL03146:Ryr1	APN	7	29094032	missense	probably benign	0.09
IGL03165:Ryr1	APN	7	29105040	missense	probably benign	0.22
IGL03220:Ryr1	APN	7	29059855	missense	probably damaging	1.00
R0017:Ryr1	UTSW	7	29047542	missense	probably damaging	1.00
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0069:Ryr1	UTSW	7	29110505	splice site	probably benign
R0148:Ryr1	UTSW	7	29052035	missense	probably damaging	0.99
R0266:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0346:Ryr1	UTSW	7	29067588	splice site	probably benign
R0387:Ryr1	UTSW	7	29083367	splice site	probably benign
R0454:Ryr1	UTSW	7	29036075	missense	probably damaging	0.99
R0494:Ryr1	UTSW	7	29003793	splice site	probably benign
R0533:Ryr1	UTSW	7	29078780	missense	probably damaging	1.00
R0585:Ryr1	UTSW	7	29036076	missense	probably damaging	1.00
R0591:Ryr1	UTSW	7	29104795	missense	possibly damaging	0.68
R0624:Ryr1	UTSW	7	29074609	missense	probably damaging	1.00
R0662:Ryr1	UTSW	7	29100189	missense	probably damaging	1.00
R0849:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0961:Ryr1	UTSW	7	29009697	missense	unknown
R1052:Ryr1	UTSW	7	29096258	missense	probably damaging	0.96
R1218:Ryr1	UTSW	7	29086109	missense	possibly damaging	0.79
R1340:Ryr1	UTSW	7	29116012	missense	probably damaging	0.99
R1513:Ryr1	UTSW	7	29070621	missense	probably damaging	1.00
R1543:Ryr1	UTSW	7	29083537	missense	possibly damaging	0.67
R1566:Ryr1	UTSW	7	29092175	missense	possibly damaging	0.95
R1572:Ryr1	UTSW	7	29062191	missense	probably damaging	1.00
R1623:Ryr1	UTSW	7	29095490	missense	probably damaging	1.00
R1632:Ryr1	UTSW	7	29094261	missense	probably benign	0.03
R1661:Ryr1	UTSW	7	29101738	missense	probably damaging	0.98
R1665:Ryr1	UTSW	7	29036078	missense	probably damaging	1.00
R1678:Ryr1	UTSW	7	29116154	missense	probably damaging	0.99
R1705:Ryr1	UTSW	7	29078564	missense	probably damaging	1.00
R1712:Ryr1	UTSW	7	29047503	missense	probably benign	0.25
R1720:Ryr1	UTSW	7	29101870	missense	probably damaging	0.99
R1799:Ryr1	UTSW	7	29067621	missense	probably damaging	1.00
R1847:Ryr1	UTSW	7	29079811	missense	probably benign	0.43
R1860:Ryr1	UTSW	7	29009552	missense	unknown
R1861:Ryr1	UTSW	7	29009552	missense	unknown
R1921:Ryr1	UTSW	7	29054944	missense	probably damaging	1.00
R1983:Ryr1	UTSW	7	29059472	missense	possibly damaging	0.74
R2043:Ryr1	UTSW	7	29059631	missense	probably damaging	0.99
R2089:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2105:Ryr1	UTSW	7	29090150	missense	probably damaging	0.99
R2175:Ryr1	UTSW	7	29068442	missense	probably damaging	1.00
R2259:Ryr1	UTSW	7	29019741	missense	unknown
R2291:Ryr1	UTSW	7	29098777	missense	probably damaging	1.00
R2351:Ryr1	UTSW	7	29075293	missense	probably benign	0.18
R2512:Ryr1	UTSW	7	29103542	missense	possibly damaging	0.64
R2571:Ryr1	UTSW	7	29009562	missense	unknown
R2571:Ryr1	UTSW	7	29036126	missense	possibly damaging	0.94
R2885:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2886:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2889:Ryr1	UTSW	7	29078741	missense	possibly damaging	0.76
R3051:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3052:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3053:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3082:Ryr1	UTSW	7	29045646	missense	probably damaging	1.00
R3103:Ryr1	UTSW	7	29074948	missense	probably damaging	1.00
R3237:Ryr1	UTSW	7	29069650	critical splice acceptor site	probably null
R3551:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3552:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3807:Ryr1	UTSW	7	29020152	missense	probably damaging	1.00
R3815:Ryr1	UTSW	7	29072902	missense	probably damaging	0.98
R4010:Ryr1	UTSW	7	29095124	missense	probably benign	0.41
R4041:Ryr1	UTSW	7	29085931	missense	possibly damaging	0.77
R4226:Ryr1	UTSW	7	29062151	nonsense	probably null
R4257:Ryr1	UTSW	7	29082450	missense	possibly damaging	0.93
R4328:Ryr1	UTSW	7	29083059	missense	probably damaging	1.00
R4394:Ryr1	UTSW	7	29094242	missense	possibly damaging	0.69
R4485:Ryr1	UTSW	7	29090156	missense	probably damaging	0.97
R4550:Ryr1	UTSW	7	29098735	missense	probably benign	0.05
R4554:Ryr1	UTSW	7	29105008	missense	probably benign	0.03
R4562:Ryr1	UTSW	7	29074580	intron	probably benign
R4642:Ryr1	UTSW	7	29086038	missense	possibly damaging	0.91
R4669:Ryr1	UTSW	7	29059831	missense	probably null	0.99
R4707:Ryr1	UTSW	7	29045662	missense	probably damaging	1.00
R4766:Ryr1	UTSW	7	29085833	missense	probably damaging	0.96
R4768:Ryr1	UTSW	7	29004821	unclassified	probably benign
R4770:Ryr1	UTSW	7	29109282	missense	probably damaging	0.99
R4780:Ryr1	UTSW	7	29095097	missense	possibly damaging	0.85
R4927:Ryr1	UTSW	7	29019983	missense	unknown
R4933:Ryr1	UTSW	7	29104298	missense	probably damaging	1.00
R4934:Ryr1	UTSW	7	29068095	missense	probably damaging	1.00
R4942:Ryr1	UTSW	7	29069573	missense	probably damaging	0.98
R4960:Ryr1	UTSW	7	29078783	missense	possibly damaging	0.82
R5007:Ryr1	UTSW	7	29069115	missense	probably damaging	1.00
R5011:Ryr1	UTSW	7	29102809	splice site	probably null
R5013:Ryr1	UTSW	7	29102809	splice site	probably null
R5137:Ryr1	UTSW	7	29101858	missense	possibly damaging	0.94
R5167:Ryr1	UTSW	7	29067693	missense	probably damaging	1.00
R5239:Ryr1	UTSW	7	29036128	missense	probably damaging	1.00
R5291:Ryr1	UTSW	7	29115598	missense	probably benign	0.03
R5303:Ryr1	UTSW	7	29068482	missense	probably damaging	1.00
R5386:Ryr1	UTSW	7	29117416	missense	probably damaging	0.98
R5431:Ryr1	UTSW	7	29109812	missense	probably benign	0.39
R5460:Ryr1	UTSW	7	29071961	missense	probably damaging	1.00
R5463:Ryr1	UTSW	7	29024023	missense	possibly damaging	0.79
R5503:Ryr1	UTSW	7	29069028	missense	possibly damaging	0.87
R5541:Ryr1	UTSW	7	29086185	missense	probably damaging	1.00
R5573:Ryr1	UTSW	7	29015723	missense	unknown
R5575:Ryr1	UTSW	7	29078693	missense	possibly damaging	0.77
R5610:Ryr1	UTSW	7	29111974	missense	probably benign	0.05
R5658:Ryr1	UTSW	7	29091089	splice site	probably null
R5918:Ryr1	UTSW	7	29009152	missense	probably benign	0.39
R5926:Ryr1	UTSW	7	29104360	missense	probably damaging	1.00
R5938:Ryr1	UTSW	7	29046865	missense	probably damaging	1.00
R5939:Ryr1	UTSW	7	29116127	missense	probably damaging	0.97
R5947:Ryr1	UTSW	7	29071924	missense	probably null	0.98
R5991:Ryr1	UTSW	7	29104610	missense	probably damaging	0.99
R5992:Ryr1	UTSW	7	29067637	missense	probably damaging	1.00
R5996:Ryr1	UTSW	7	29024241	missense	probably benign	0.38
R6075:Ryr1	UTSW	7	29087438	missense	probably damaging	1.00
R6091:Ryr1	UTSW	7	29071973	missense	probably benign	0.01
R6126:Ryr1	UTSW	7	29076239	missense	probably null	1.00
R6147:Ryr1	UTSW	7	29085914	missense	possibly damaging	0.88
R6235:Ryr1	UTSW	7	29116181	missense	probably benign	0.07
R6279:Ryr1	UTSW	7	29087428	missense	possibly damaging	0.93
R6381:Ryr1	UTSW	7	29075257	missense	possibly damaging	0.87
R6441:Ryr1	UTSW	7	29059695	missense	possibly damaging	0.95
R6443:Ryr1	UTSW	7	29077078	missense	probably damaging	0.97
R6459:Ryr1	UTSW	7	29015654	missense	probably benign	0.39
R6514:Ryr1	UTSW	7	29046841	missense	probably damaging	1.00
R6563:Ryr1	UTSW	7	29095492	missense	possibly damaging	0.92
R6660:Ryr1	UTSW	7	29038345	critical splice donor site	probably null
R6746:Ryr1	UTSW	7	29117404	missense	possibly damaging	0.56
R6785:Ryr1	UTSW	7	29064874	missense	probably benign	0.12
R6800:Ryr1	UTSW	7	29024316	missense	possibly damaging	0.95
R6939:Ryr1	UTSW	7	29052326	missense	possibly damaging	0.91
R6980:Ryr1	UTSW	7	29109387	missense	probably benign	0.03
R6995:Ryr1	UTSW	7	29094182	missense	probably damaging	0.97
R7065:Ryr1	UTSW	7	29103643	missense	probably damaging	1.00
R7123:Ryr1	UTSW	7	29046854	missense	probably benign	0.37
R7240:Ryr1	UTSW	7	29052015	missense	possibly damaging	0.95
R7300:Ryr1	UTSW	7	29059511	missense	probably damaging	1.00
R7365:Ryr1	UTSW	7	29085755	missense	probably benign	0.05
R7403:Ryr1	UTSW	7	29013867	missense	probably benign	0.34
R7422:Ryr1	UTSW	7	29085870	missense	probably benign	0.00
R7493:Ryr1	UTSW	7	29095205	missense	probably benign	0.44
R7570:Ryr1	UTSW	7	29078585	missense	probably damaging	0.98
R7593:Ryr1	UTSW	7	29036103	missense	probably damaging	1.00
R7769:Ryr1	UTSW	7	29098785	missense	probably damaging	1.00
R7781:Ryr1	UTSW	7	29067630	missense	probably damaging	1.00
R7790:Ryr1	UTSW	7	29104832	missense	probably benign	0.39
R7799:Ryr1	UTSW	7	29003560	splice site	probably null
R7916:Ryr1	UTSW	7	29090939	nonsense	probably null
R7922:Ryr1	UTSW	7	29097224	missense	probably benign	0.09
R7988:Ryr1	UTSW	7	29096171	missense	probably benign	0.29
R7997:Ryr1	UTSW	7	29003543	missense	unknown
R8052:Ryr1	UTSW	7	29083385	missense	probably benign	0.05
R8096:Ryr1	UTSW	7	29009201	missense	unknown
R8116:Ryr1	UTSW	7	29110883	missense	probably benign	0.03
R8202:Ryr1	UTSW	7	29091032	missense	probably benign	0.18
R8207:Ryr1	UTSW	7	29090225	missense	probably damaging	1.00
R8248:Ryr1	UTSW	7	29069121	missense	probably damaging	1.00
R8257:Ryr1	UTSW	7	29064639	missense	possibly damaging	0.82
R8354:Ryr1	UTSW	7	29015717	missense	unknown
R8454:Ryr1	UTSW	7	29015717	missense	unknown
R8487:Ryr1	UTSW	7	29040867	missense	probably damaging	0.97
R8529:Ryr1	UTSW	7	29070084	missense	possibly damaging	0.86
R8545:Ryr1	UTSW	7	29004814	unclassified	probably benign
R8678:Ryr1	UTSW	7	29077064	missense	probably damaging	0.99
R8717:Ryr1	UTSW	7	29052328	missense	probably benign	0.03
R8724:Ryr1	UTSW	7	29117377	missense	probably benign	0.04
R8755:Ryr1	UTSW	7	29092268	missense	probably benign	0.19
R8772:Ryr1	UTSW	7	29116132	missense	probably benign	0.05
R8790:Ryr1	UTSW	7	29076872	missense	probably damaging	1.00
R8793:Ryr1	UTSW	7	29064859	missense	probably damaging	1.00
R8836:Ryr1	UTSW	7	29074666	missense	probably damaging	1.00
R8858:Ryr1	UTSW	7	29109213	missense	probably benign	0.00
R8910:Ryr1	UTSW	7	29071915	missense	probably damaging	1.00
R8920:Ryr1	UTSW	7	29090215	missense	possibly damaging	0.89
R8938:Ryr1	UTSW	7	29101933	missense	probably damaging	1.00
R9035:Ryr1	UTSW	7	29090997	missense	probably damaging	0.97
R9115:Ryr1	UTSW	7	29104564	nonsense	probably null
R9123:Ryr1	UTSW	7	29071804	missense	probably damaging	1.00
R9154:Ryr1	UTSW	7	29069858	missense	probably benign	0.08
R9189:Ryr1	UTSW	7	29077046	missense	probably damaging	1.00
R9200:Ryr1	UTSW	7	29095099	missense	probably benign	0.00
R9214:Ryr1	UTSW	7	29085762	missense	possibly damaging	0.52
R9216:Ryr1	UTSW	7	29101852	missense	probably damaging	0.97
R9240:Ryr1	UTSW	7	29043888	missense	probably damaging	1.00
R9261:Ryr1	UTSW	7	29052388	missense	possibly damaging	0.91
R9276:Ryr1	UTSW	7	29102829	missense	probably damaging	0.99
R9280:Ryr1	UTSW	7	29102964	missense	probably damaging	1.00
R9316:Ryr1	UTSW	7	29017962	missense	unknown
R9333:Ryr1	UTSW	7	29074789	critical splice donor site	probably null
R9459:Ryr1	UTSW	7	29068643	missense	probably damaging	1.00
R9468:Ryr1	UTSW	7	29073085	missense	probably damaging	1.00
R9486:Ryr1	UTSW	7	29078540	missense	probably benign	0.15
R9524:Ryr1	UTSW	7	29024175	missense	probably damaging	1.00
R9620:Ryr1	UTSW	7	29015713	missense	unknown
R9664:Ryr1	UTSW	7	29059667	missense	probably damaging	1.00
R9776:Ryr1	UTSW	7	29075239	missense	probably damaging	1.00
X0021:Ryr1	UTSW	7	29061531	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29020214	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29086035	missense	probably benign	0.10
Z1176:Ryr1	UTSW	7	29103498	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	29017985	missense	unknown
Z1177:Ryr1	UTSW	7	29048792	nonsense	probably null
Z1177:Ryr1	UTSW	7	29101922	missense	probably damaging	1.00
Z1186:Ryr1	UTSW	7	29082477	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- AACCTCAGGGAGCTCACATC -3'
(R):5'- ATGCCTCTCATTGTGGGTTC -3'

Sequencing Primer
(F):5'- AGGGAGCTCACATCCTGGC -3'
(R):5'- TGGGGTTCTCCTCGCAG -3'

Posted On

2019-06-26