Incidental Mutation 'R7238:Tenm4'
ID 562989
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms l7Rn3, Doc4, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 045345-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7238 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 95820453-96560300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 96202703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 106 (R106H)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166] [ENSMUST00000129737] [ENSMUST00000138760]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107162
AA Change: R81H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: R81H

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107165
AA Change: R106H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: R106H

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107166
AA Change: R106H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: R106H

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129737
SMART Domains Protein: ENSMUSP00000120529
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 60 125 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138760
SMART Domains Protein: ENSMUSP00000114281
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 35 100 6.5e-34 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,775,712 (GRCm39) T1634S probably damaging Het
Adgrl1 T A 8: 84,665,693 (GRCm39) M1460K probably damaging Het
Adig T A 2: 158,347,773 (GRCm39) L29Q unknown Het
Adnp T G 2: 168,025,887 (GRCm39) K469N probably damaging Het
Akap3 A G 6: 126,842,200 (GRCm39) D273G probably benign Het
Albfm1 A T 5: 90,727,519 (GRCm39) Y379F probably damaging Het
Ankrd34b T C 13: 92,575,139 (GRCm39) Y124H possibly damaging Het
Ap2b1 T G 11: 83,223,948 (GRCm39) F221C possibly damaging Het
Atp2c2 A G 8: 120,469,160 (GRCm39) I358V possibly damaging Het
BC051665 G A 13: 60,930,536 (GRCm39) T272I probably benign Het
Cdan1 G T 2: 120,560,783 (GRCm39) A262E probably benign Het
Ces1d C T 8: 93,904,763 (GRCm39) V326I probably benign Het
Chd3 T C 11: 69,254,873 (GRCm39) R156G probably benign Het
Clip1 C T 5: 123,751,328 (GRCm39) E818K Het
Col6a4 C T 9: 105,877,519 (GRCm39) V2153M probably damaging Het
Crlf3 T C 11: 79,947,351 (GRCm39) N296D possibly damaging Het
Cstdc6 C T 16: 36,142,193 (GRCm39) G61D probably benign Het
D130052B06Rik A G 11: 33,573,594 (GRCm39) I109V probably benign Het
Dcaf5 G T 12: 80,385,483 (GRCm39) T881K probably benign Het
Dennd4a C A 9: 64,769,238 (GRCm39) T408K probably damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah2 A G 11: 69,349,972 (GRCm39) probably null Het
Eif1ad8 A T 12: 87,564,006 (GRCm39) K114* probably null Het
Eif2ak2 C T 17: 79,173,760 (GRCm39) V273I probably benign Het
Elac1 C T 18: 73,872,359 (GRCm39) G212D probably damaging Het
Ercc6l2 A G 13: 64,013,798 (GRCm39) D623G probably damaging Het
Exo1 T C 1: 175,716,413 (GRCm39) F177L probably damaging Het
Fat4 A G 3: 38,944,562 (GRCm39) T1152A probably benign Het
Fbxl12 G T 9: 20,529,709 (GRCm39) probably null Het
Fbxo43 T C 15: 36,151,971 (GRCm39) Y582C probably damaging Het
Fsip2 T A 2: 82,812,484 (GRCm39) N2934K possibly damaging Het
Gna12 A G 5: 140,815,847 (GRCm39) S69P probably damaging Het
Gpatch8 C A 11: 102,369,354 (GRCm39) G1395C probably damaging Het
Gpr137c A G 14: 45,516,148 (GRCm39) Y294C probably damaging Het
Greb1 A G 12: 16,724,673 (GRCm39) S1834P probably damaging Het
Grin2b T C 6: 135,757,249 (GRCm39) D404G probably damaging Het
Hectd2 A T 19: 36,574,478 (GRCm39) N236I probably damaging Het
Hhip C T 8: 80,713,641 (GRCm39) V562I probably benign Het
Hipk2 G T 6: 38,692,992 (GRCm39) T867N probably benign Het
Hmgcl T C 4: 135,689,424 (GRCm39) V294A possibly damaging Het
Hnrnpl T A 7: 28,513,400 (GRCm39) F158I Het
Hspa5 T C 2: 34,662,383 (GRCm39) V17A unknown Het
Hspg2 T C 4: 137,235,704 (GRCm39) V168A probably damaging Het
Idh1 A G 1: 65,205,284 (GRCm39) F227S probably damaging Het
Iigp1c A G 18: 60,379,355 (GRCm39) S297G possibly damaging Het
Immp2l T C 12: 41,160,915 (GRCm39) V71A possibly damaging Het
Iqce G A 5: 140,675,713 (GRCm39) R193* probably null Het
Kcnq5 T C 1: 21,472,526 (GRCm39) D907G probably benign Het
Krt17 T A 11: 100,148,613 (GRCm39) T306S probably benign Het
Lhx3 T C 2: 26,093,009 (GRCm39) D149G probably damaging Het
Lrrc73 G A 17: 46,565,488 (GRCm39) R73H probably damaging Het
Mgat5b T C 11: 116,875,809 (GRCm39) S678P probably benign Het
Mink1 T C 11: 70,502,305 (GRCm39) probably null Het
Mroh5 T G 15: 73,663,278 (GRCm39) probably null Het
Muc5ac T A 7: 141,363,254 (GRCm39) H2188Q unknown Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Musk G A 4: 58,344,312 (GRCm39) G305D probably benign Het
Mx1 A G 16: 97,249,496 (GRCm39) I347T unknown Het
Mybbp1a G T 11: 72,334,338 (GRCm39) V198F probably damaging Het
Mycbp2 A G 14: 103,393,733 (GRCm39) S2943P probably damaging Het
Myo18a G A 11: 77,733,059 (GRCm39) R1363K probably damaging Het
Nav3 T A 10: 109,689,185 (GRCm39) D364V possibly damaging Het
Or13g1 T C 7: 85,955,799 (GRCm39) H174R probably damaging Het
Or14j6 T C 17: 38,215,328 (GRCm39) L297S probably benign Het
Or1e26 A T 11: 73,480,561 (GRCm39) M1K probably null Het
Or1j13 T A 2: 36,369,726 (GRCm39) N139Y possibly damaging Het
Or5k15 T A 16: 58,710,252 (GRCm39) E110D probably damaging Het
Pecr T C 1: 72,298,592 (GRCm39) D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Ppp1cb A T 5: 32,648,376 (GRCm39) T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 (GRCm39) K1084N probably damaging Het
Prdm2 A G 4: 142,862,391 (GRCm39) S300P probably benign Het
Prkg1 C T 19: 30,602,090 (GRCm39) V389I probably damaging Het
Psg25 C T 7: 18,266,127 (GRCm39) probably benign Het
Ptpn6 A G 6: 124,698,821 (GRCm39) S498P possibly damaging Het
Pus3 A G 9: 35,477,965 (GRCm39) H399R probably benign Het
Pus7 T C 5: 23,983,450 (GRCm39) T6A probably benign Het
Rnf169 A G 7: 99,574,954 (GRCm39) V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,128 (GRCm39) probably benign Het
Ryr1 C T 7: 28,794,807 (GRCm39) D1194N probably benign Het
Scn5a T C 9: 119,320,610 (GRCm39) M1490V possibly damaging Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Selenoo T A 15: 88,973,427 (GRCm39) M39K probably benign Het
Septin8 T G 11: 53,427,519 (GRCm39) V246G possibly damaging Het
Serpina3k T A 12: 104,309,367 (GRCm39) N270K probably damaging Het
Setd5 G A 6: 113,098,091 (GRCm39) R710H probably damaging Het
Sirt4 A T 5: 115,621,049 (GRCm39) I41N possibly damaging Het
Slc26a9 T A 1: 131,686,556 (GRCm39) Y425* probably null Het
Slc4a9 A G 18: 36,662,773 (GRCm39) E176G probably benign Het
Speer1m T C 5: 11,970,712 (GRCm39) I127T Het
Spidr A T 16: 15,784,680 (GRCm39) W463R probably benign Het
Tmcc1 G A 6: 116,111,198 (GRCm39) Q28* probably null Het
Tmem52b A G 6: 129,493,651 (GRCm39) E88G probably damaging Het
Trpc7 A T 13: 56,974,710 (GRCm39) I402K probably benign Het
Tshz3 T C 7: 36,469,522 (GRCm39) Y504H probably damaging Het
Ttn T C 2: 76,542,549 (GRCm39) E33479G possibly damaging Het
Ttn G A 2: 76,711,672 (GRCm39) R8290C unknown Het
Urb1 T C 16: 90,549,003 (GRCm39) D2235G possibly damaging Het
Usp10 T C 8: 120,668,283 (GRCm39) F195L probably benign Het
Vmn1r31 A T 6: 58,449,858 (GRCm39) F2L Het
Vmn2r109 C T 17: 20,761,336 (GRCm39) V674M probably damaging Het
Vmn2r12 G A 5: 109,245,655 (GRCm39) P26S possibly damaging Het
Vmn2r61 T A 7: 41,916,629 (GRCm39) M414K possibly damaging Het
Yipf3 T C 17: 46,562,585 (GRCm39) V330A probably benign Het
Zic4 A T 9: 91,261,450 (GRCm39) H235L probably benign Het
Zxdc T A 6: 90,346,642 (GRCm39) W16R unknown Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96,517,216 (GRCm39) missense probably benign 0.00
IGL00468:Tenm4 APN 7 96,523,679 (GRCm39) missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96,454,345 (GRCm39) splice site probably benign
IGL00979:Tenm4 APN 7 96,378,598 (GRCm39) missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96,523,474 (GRCm39) missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96,378,592 (GRCm39) missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96,544,384 (GRCm39) missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96,523,510 (GRCm39) missense probably benign 0.00
IGL01579:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01587:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01625:Tenm4 APN 7 96,534,565 (GRCm39) missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96,202,931 (GRCm39) missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96,534,611 (GRCm39) missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96,545,271 (GRCm39) missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96,544,716 (GRCm39) missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96,544,419 (GRCm39) missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96,202,757 (GRCm39) missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96,544,869 (GRCm39) missense probably benign 0.40
IGL02207:Tenm4 APN 7 96,523,323 (GRCm39) missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96,473,029 (GRCm39) missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96,503,941 (GRCm39) missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96,353,344 (GRCm39) missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96,523,281 (GRCm39) missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96,423,383 (GRCm39) unclassified probably benign
IGL02656:Tenm4 APN 7 96,534,640 (GRCm39) missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96,545,426 (GRCm39) missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96,544,205 (GRCm39) nonsense probably null
IGL02863:Tenm4 APN 7 96,522,913 (GRCm39) missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96,492,175 (GRCm39) missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96,522,969 (GRCm39) missense probably damaging 1.00
principium UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
toccata UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
P0026:Tenm4 UTSW 7 96,523,734 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96,545,259 (GRCm39) missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96,378,547 (GRCm39) splice site probably benign
R0277:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96,421,242 (GRCm39) nonsense probably null
R0381:Tenm4 UTSW 7 96,555,088 (GRCm39) missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96,522,973 (GRCm39) missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96,427,058 (GRCm39) missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96,544,830 (GRCm39) missense probably benign 0.35
R0624:Tenm4 UTSW 7 96,423,227 (GRCm39) missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96,545,482 (GRCm39) splice site probably benign
R1037:Tenm4 UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96,497,251 (GRCm39) missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96,199,258 (GRCm39) missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96,492,255 (GRCm39) missense probably benign 0.42
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
R1701:Tenm4 UTSW 7 96,552,096 (GRCm39) missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96,537,892 (GRCm39) missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96,522,987 (GRCm39) missense probably benign 0.17
R1812:Tenm4 UTSW 7 96,545,147 (GRCm39) missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96,544,533 (GRCm39) missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96,555,497 (GRCm39) missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96,552,054 (GRCm39) missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96,555,216 (GRCm39) missense probably benign 0.03
R2329:Tenm4 UTSW 7 96,545,069 (GRCm39) missense probably benign 0.00
R2893:Tenm4 UTSW 7 96,544,197 (GRCm39) missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96,542,332 (GRCm39) splice site probably null
R3409:Tenm4 UTSW 7 96,544,367 (GRCm39) missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3441:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3719:Tenm4 UTSW 7 96,512,770 (GRCm39) missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96,544,979 (GRCm39) missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4441:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4510:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4511:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4543:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4645:Tenm4 UTSW 7 96,544,949 (GRCm39) missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96,544,131 (GRCm39) missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96,446,691 (GRCm39) missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96,555,025 (GRCm39) splice site probably null
R5036:Tenm4 UTSW 7 96,501,768 (GRCm39) missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96,343,997 (GRCm39) missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96,544,995 (GRCm39) missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96,492,164 (GRCm39) missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96,492,356 (GRCm39) missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96,542,293 (GRCm39) missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96,523,410 (GRCm39) missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96,486,538 (GRCm39) missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96,538,034 (GRCm39) missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96,543,887 (GRCm39) missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96,545,416 (GRCm39) nonsense probably null
R5590:Tenm4 UTSW 7 96,446,608 (GRCm39) missense possibly damaging 0.93
R5590:Tenm4 UTSW 7 96,446,607 (GRCm39) missense possibly damaging 0.73
R5597:Tenm4 UTSW 7 96,202,724 (GRCm39) missense probably benign 0.00
R5782:Tenm4 UTSW 7 96,542,246 (GRCm39) missense probably benign 0.00
R5861:Tenm4 UTSW 7 96,492,424 (GRCm39) intron probably benign
R5890:Tenm4 UTSW 7 96,552,067 (GRCm39) missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96,503,926 (GRCm39) missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96,495,102 (GRCm39) missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96,171,640 (GRCm39) intron probably benign
R6060:Tenm4 UTSW 7 96,522,918 (GRCm39) missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96,486,496 (GRCm39) missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96,523,701 (GRCm39) missense probably benign 0.33
R6333:Tenm4 UTSW 7 96,423,331 (GRCm39) missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96,492,251 (GRCm39) missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6746:Tenm4 UTSW 7 96,542,067 (GRCm39) missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96,494,919 (GRCm39) missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96,461,166 (GRCm39) missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96,544,478 (GRCm39) missense probably damaging 1.00
R6807:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6809:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6810:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6811:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6853:Tenm4 UTSW 7 96,486,502 (GRCm39) missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96,446,599 (GRCm39) missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96,544,757 (GRCm39) missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6939:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7011:Tenm4 UTSW 7 96,545,342 (GRCm39) nonsense probably null
R7033:Tenm4 UTSW 7 96,544,430 (GRCm39) nonsense probably null
R7040:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7083:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R7239:Tenm4 UTSW 7 96,385,020 (GRCm39) missense possibly damaging 0.47
R7239:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7337:Tenm4 UTSW 7 96,523,333 (GRCm39) missense probably benign 0.44
R7400:Tenm4 UTSW 7 96,344,010 (GRCm39) missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96,423,194 (GRCm39) missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96,523,420 (GRCm39) missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96,423,353 (GRCm39) missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96,495,015 (GRCm39) missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96,486,521 (GRCm39) missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96,497,224 (GRCm39) missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96,538,021 (GRCm39) missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96,495,133 (GRCm39) missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96,545,192 (GRCm39) missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96,542,221 (GRCm39) missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96,512,740 (GRCm39) missense probably benign 0.00
R7692:Tenm4 UTSW 7 96,544,610 (GRCm39) missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96,543,909 (GRCm39) missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96,544,899 (GRCm39) missense probably benign 0.38
R7792:Tenm4 UTSW 7 96,423,221 (GRCm39) missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96,523,081 (GRCm39) missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96,555,587 (GRCm39) missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96,501,564 (GRCm39) missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96,523,512 (GRCm39) missense probably benign 0.44
R8017:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96,378,553 (GRCm39) splice site probably benign
R8061:Tenm4 UTSW 7 96,501,663 (GRCm39) missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96,503,935 (GRCm39) missense probably benign 0.39
R8140:Tenm4 UTSW 7 96,544,383 (GRCm39) missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96,544,614 (GRCm39) missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96,421,313 (GRCm39) critical splice donor site probably null
R8542:Tenm4 UTSW 7 96,461,139 (GRCm39) missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8670:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8683:Tenm4 UTSW 7 96,552,064 (GRCm39) missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8692:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8714:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8716:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8735:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8736:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8737:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,523,047 (GRCm39) missense probably damaging 1.00
R8739:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8776:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96,523,335 (GRCm39) missense probably benign 0.01
R8851:Tenm4 UTSW 7 96,501,710 (GRCm39) missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96,351,952 (GRCm39) splice site probably benign
R8977:Tenm4 UTSW 7 96,461,177 (GRCm39) missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96,495,061 (GRCm39) missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96,473,125 (GRCm39) missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96,473,080 (GRCm39) missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96,421,234 (GRCm39) missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96,542,126 (GRCm39) missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96,534,646 (GRCm39) missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96,545,352 (GRCm39) missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96,545,367 (GRCm39) missense probably benign
R9466:Tenm4 UTSW 7 96,199,252 (GRCm39) missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96,473,056 (GRCm39) missense probably benign
R9626:Tenm4 UTSW 7 96,545,345 (GRCm39) missense probably damaging 1.00
R9673:Tenm4 UTSW 7 96,517,196 (GRCm39) missense probably damaging 1.00
R9676:Tenm4 UTSW 7 96,544,638 (GRCm39) missense probably damaging 1.00
R9678:Tenm4 UTSW 7 96,386,619 (GRCm39) missense possibly damaging 0.94
R9775:Tenm4 UTSW 7 96,555,761 (GRCm39) missense possibly damaging 0.92
R9790:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9791:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9803:Tenm4 UTSW 7 96,202,685 (GRCm39) missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96,523,116 (GRCm39) nonsense probably null
X0026:Tenm4 UTSW 7 96,517,294 (GRCm39) missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96,544,001 (GRCm39) missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96,497,237 (GRCm39) missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96,555,121 (GRCm39) missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96,512,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTTCATGCATGGCACTTGGC -3'
(R):5'- TAACCCCGTGTAACCAACGG -3'

Sequencing Primer
(F):5'- CATGCATGGCACTTGGCTAGAG -3'
(R):5'- GAGCCACTCACCGGTTTCTG -3'
Posted On 2019-06-26