Mutagenetix > Incidental Mutation

Incidental Mutation 'R7238:Tenm4'

562989

Institutional Source

Beutler Lab

Gene Symbol

Tenm4

Ensembl Gene

ENSMUSG00000048078

Gene Name

teneurin transmembrane protein 4

Synonyms

Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7238 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96171246-96911093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 96553496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 106 (R106H)

Ref Sequence

ENSEMBL: ENSMUSP00000102783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166] [ENSMUST00000129737] [ENSMUST00000138760]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000107162
AA Change: R81H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: R81H

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	410	5.6e-195	PFAM
transmembrane domain	411	433	N/A	INTRINSIC
EGF_like	637	665	3.43e1	SMART
EGF	668	696	2.29e1	SMART
EGF	701	730	1.88e-1	SMART
EGF	733	762	1.13e1	SMART
EGF	767	797	2.39e1	SMART
EGF	800	828	4.32e-1	SMART
EGF	831	859	6.02e0	SMART
EGF	862	894	9.93e-1	SMART
low complexity region	900	914	N/A	INTRINSIC
Pfam:RHS_repeat	2327	2380	5.5e-7	PFAM
Pfam:Tox-GHH	2740	2818	5.2e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107165
AA Change: R106H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: R106H

Domain	Start	End	E-Value	Type
Pfam:Ten_N	36	402	1.1e-171	PFAM
transmembrane domain	403	425	N/A	INTRINSIC
EGF_like	629	657	3.43e1	SMART
EGF	660	688	2.29e1	SMART
EGF	693	722	1.88e-1	SMART
EGF	725	754	1.13e1	SMART
EGF	759	789	2.39e1	SMART
EGF	792	820	4.32e-1	SMART
EGF	823	851	6.02e0	SMART
EGF	863	895	9.93e-1	SMART
low complexity region	901	915	N/A	INTRINSIC
Pfam:RHS_repeat	2335	2368	1.6e-7	PFAM
Pfam:Tox-GHH	2749	2826	1.8e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107166
AA Change: R106H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: R106H

Domain	Start	End	E-Value	Type
Pfam:Ten_N	35	193	1.4e-83	PFAM
Pfam:Ten_N	187	365	5e-78	PFAM
transmembrane domain	366	388	N/A	INTRINSIC
EGF_like	592	620	3.43e1	SMART
EGF	623	651	2.29e1	SMART
EGF	656	685	1.88e-1	SMART
EGF	688	717	1.13e1	SMART
EGF	722	752	2.39e1	SMART
EGF	755	783	4.32e-1	SMART
EGF	786	814	6.02e0	SMART
EGF	826	858	9.93e-1	SMART
low complexity region	864	878	N/A	INTRINSIC
Pfam:RHS_repeat	2298	2351	3.8e-7	PFAM
Pfam:Tox-GHH	2711	2789	3.9e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129737

SMART Domains

Protein: ENSMUSP00000120529
Gene: ENSMUSG00000048078

Domain	Start	End	E-Value	Type
Pfam:Ten_N	60	125	6.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138760

SMART Domains

Protein: ENSMUSP00000114281
Gene: ENSMUSG00000048078

Domain	Start	End	E-Value	Type
Pfam:Ten_N	35	100	6.5e-34	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

97% (104/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,069,951	T1634S	probably damaging	Het
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
4933402N22Rik	T	C	5: 11,920,745	I127T		Het
5830473C10Rik	A	T	5: 90,579,660	Y379F	probably damaging	Het
Adgrl1	T	A	8: 83,939,064	M1460K	probably damaging	Het
Adig	T	A	2: 158,505,853	L29Q	unknown	Het
Adnp	T	G	2: 168,183,967	K469N	probably damaging	Het
Akap3	A	G	6: 126,865,237	D273G	probably benign	Het
Ankrd34b	T	C	13: 92,438,631	Y124H	possibly damaging	Het
Ap2b1	T	G	11: 83,333,122	F221C	possibly damaging	Het
Atp2c2	A	G	8: 119,742,421	I358V	possibly damaging	Het
BC051665	G	A	13: 60,782,722	T272I	probably benign	Het
BC117090	C	T	16: 36,321,831	G61D	probably benign	Het
Cdan1	G	T	2: 120,730,302	A262E	probably benign	Het
Ces1d	C	T	8: 93,178,135	V326I	probably benign	Het
Chd3	T	C	11: 69,364,047	R156G	probably benign	Het
Clip1	C	T	5: 123,613,265	E818K		Het
Col6a4	C	T	9: 106,000,320	V2153M	probably damaging	Het
Crlf3	T	C	11: 80,056,525	N296D	possibly damaging	Het
D130052B06Rik	A	G	11: 33,623,594	I109V	probably benign	Het
Dcaf5	G	T	12: 80,338,709	T881K	probably benign	Het
Dennd4a	C	A	9: 64,861,956	T408K	probably damaging	Het
Dnah2	A	G	11: 69,459,146		probably null	Het
Eif2ak2	C	T	17: 78,866,331	V273I	probably benign	Het
Elac1	C	T	18: 73,739,288	G212D	probably damaging	Het
Ercc6l2	A	G	13: 63,865,984	D623G	probably damaging	Het
Exo1	T	C	1: 175,888,847	F177L	probably damaging	Het
Fat4	A	G	3: 38,890,413	T1152A	probably benign	Het
Fbxl12	G	T	9: 20,618,413		probably null	Het
Fbxo43	T	C	15: 36,151,825	Y582C	probably damaging	Het
Fsip2	T	A	2: 82,982,140	N2934K	possibly damaging	Het
Gm4951	A	G	18: 60,246,283	S297G	possibly damaging	Het
Gm8300	A	T	12: 87,517,236	K114*	probably null	Het
Gna12	A	G	5: 140,830,092	S69P	probably damaging	Het
Gpatch8	C	A	11: 102,478,528	G1395C	probably damaging	Het
Gpr137c	A	G	14: 45,278,691	Y294C	probably damaging	Het
Greb1	A	G	12: 16,674,672	S1834P	probably damaging	Het
Grin2b	T	C	6: 135,780,251	D404G	probably damaging	Het
Hectd2	A	T	19: 36,597,078	N236I	probably damaging	Het
Hhip	C	T	8: 79,987,012	V562I	probably benign	Het
Hipk2	G	T	6: 38,716,057	T867N	probably benign	Het
Hmgcl	T	C	4: 135,962,113	V294A	possibly damaging	Het
Hnrnpl	T	A	7: 28,813,975	F158I		Het
Hspa5	T	C	2: 34,772,371	V17A	unknown	Het
Hspg2	T	C	4: 137,508,393	V168A	probably damaging	Het
Idh1	A	G	1: 65,166,125	F227S	probably damaging	Het
Immp2l	T	C	12: 41,110,916	V71A	possibly damaging	Het
Iqce	G	A	5: 140,689,958	R193*	probably null	Het
Kcnq5	T	C	1: 21,402,302	D907G	probably benign	Het
Krt17	T	A	11: 100,257,787	T306S	probably benign	Het
Lhx3	T	C	2: 26,202,997	D149G	probably damaging	Het
Lrrc73	G	A	17: 46,254,562	R73H	probably damaging	Het
Mgat5b	T	C	11: 116,984,983	S678P	probably benign	Het
Mink1	T	C	11: 70,611,479		probably null	Het
Mroh5	T	G	15: 73,791,429		probably null	Het
Muc5ac	T	A	7: 141,809,517	H2188Q	unknown	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Musk	G	A	4: 58,344,312	G305D	probably benign	Het
Mx1	A	G	16: 97,448,296	I347T	unknown	Het
Mybbp1a	G	T	11: 72,443,512	V198F	probably damaging	Het
Mycbp2	A	G	14: 103,156,297	S2943P	probably damaging	Het
Myo18a	G	A	11: 77,842,233	R1363K	probably damaging	Het
Nav3	T	A	10: 109,853,324	D364V	possibly damaging	Het
Olfr127	T	C	17: 37,904,437	L297S	probably benign	Het
Olfr178	T	A	16: 58,889,889	E110D	probably damaging	Het
Olfr309	T	C	7: 86,306,591	H174R	probably damaging	Het
Olfr341	T	A	2: 36,479,714	N139Y	possibly damaging	Het
Olfr385	A	T	11: 73,589,735	M1K	probably null	Het
Pecr	T	C	1: 72,259,433	D276G	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Ppp1cb	A	T	5: 32,491,032	T320S	probably benign	Het
Ppp1r9a	G	T	6: 5,159,716	K1084N	probably damaging	Het
Prdm2	A	G	4: 143,135,821	S300P	probably benign	Het
Prkg1	C	T	19: 30,624,690	V389I	probably damaging	Het
Psg25	C	T	7: 18,532,202		probably benign	Het
Ptpn6	A	G	6: 124,721,858	S498P	possibly damaging	Het
Pus3	A	G	9: 35,566,669	H399R	probably benign	Het
Pus7	T	C	5: 23,778,452	T6A	probably benign	Het
Rnf169	A	G	7: 99,925,747	V547A	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,921		probably benign	Het
Ryr1	C	T	7: 29,095,382	D1194N	probably benign	Het
Scn5a	T	C	9: 119,491,544	M1490V	possibly damaging	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Selenoo	T	A	15: 89,089,224	M39K	probably benign	Het
Sept8	T	G	11: 53,536,692	V246G	possibly damaging	Het
Serpina3k	T	A	12: 104,343,108	N270K	probably damaging	Het
Setd5	G	A	6: 113,121,130	R710H	probably damaging	Het
Sirt4	A	T	5: 115,482,990	I41N	possibly damaging	Het
Slc26a9	T	A	1: 131,758,818	Y425*	probably null	Het
Slc4a9	A	G	18: 36,529,720	E176G	probably benign	Het
Spidr	A	T	16: 15,966,816	W463R	probably benign	Het
Tmcc1	G	A	6: 116,134,237	Q28*	probably null	Het
Tmem52b	A	G	6: 129,516,688	E88G	probably damaging	Het
Trpc7	A	T	13: 56,826,897	I402K	probably benign	Het
Tshz3	T	C	7: 36,770,097	Y504H	probably damaging	Het
Ttn	T	C	2: 76,712,205	E33479G	possibly damaging	Het
Ttn	G	A	2: 76,881,328	R8290C	unknown	Het
Urb1	T	C	16: 90,752,115	D2235G	possibly damaging	Het
Usp10	T	C	8: 119,941,544	F195L	probably benign	Het
Vmn1r31	A	T	6: 58,472,873	F2L		Het
Vmn2r109	C	T	17: 20,541,074	V674M	probably damaging	Het
Vmn2r12	G	A	5: 109,097,789	P26S	possibly damaging	Het
Vmn2r61	T	A	7: 42,267,205	M414K	possibly damaging	Het
Yipf3	T	C	17: 46,251,659	V330A	probably benign	Het
Zic4	A	T	9: 91,379,397	H235L	probably benign	Het
Zxdc	T	A	6: 90,369,660	W16R	unknown	Het

Other mutations in Tenm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Tenm4	APN	7	96868009	missense	probably benign	0.00
IGL00468:Tenm4	APN	7	96874472	missense	probably damaging	0.98
IGL00519:Tenm4	APN	7	96805138	splice site	probably benign
IGL00979:Tenm4	APN	7	96729391	missense	probably damaging	0.96
IGL01401:Tenm4	APN	7	96874267	missense	probably damaging	1.00
IGL01459:Tenm4	APN	7	96729385	missense	probably damaging	1.00
IGL01519:Tenm4	APN	7	96895177	missense	probably damaging	1.00
IGL01545:Tenm4	APN	7	96874303	missense	probably benign	0.00
IGL01579:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01587:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01625:Tenm4	APN	7	96885358	missense	probably damaging	1.00
IGL01655:Tenm4	APN	7	96553724	missense	probably damaging	1.00
IGL01683:Tenm4	APN	7	96885404	missense	possibly damaging	0.84
IGL01728:Tenm4	APN	7	96896064	missense	probably damaging	1.00
IGL01732:Tenm4	APN	7	96895509	missense	probably damaging	1.00
IGL01924:Tenm4	APN	7	96895212	missense	probably damaging	1.00
IGL01966:Tenm4	APN	7	96553550	missense	probably damaging	1.00
IGL02177:Tenm4	APN	7	96895662	missense	probably benign	0.40
IGL02207:Tenm4	APN	7	96874116	missense	possibly damaging	0.85
IGL02269:Tenm4	APN	7	96823822	missense	probably damaging	1.00
IGL02274:Tenm4	APN	7	96854734	missense	probably damaging	1.00
IGL02375:Tenm4	APN	7	96704137	missense	possibly damaging	0.52
IGL02415:Tenm4	APN	7	96874074	missense	probably damaging	0.98
IGL02472:Tenm4	APN	7	96774176	unclassified	probably benign
IGL02656:Tenm4	APN	7	96885433	missense	probably damaging	1.00
IGL02678:Tenm4	APN	7	96896219	missense	probably damaging	1.00
IGL02829:Tenm4	APN	7	96894998	nonsense	probably null
IGL02863:Tenm4	APN	7	96873706	missense	probably damaging	1.00
IGL03145:Tenm4	APN	7	96842968	missense	probably damaging	0.98
IGL03153:Tenm4	APN	7	96873762	missense	probably damaging	1.00
principium	UTSW	7	96797481	missense	probably damaging	0.98
toccata	UTSW	7	96902989	critical splice donor site	probably null
P0026:Tenm4	UTSW	7	96874527	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0140:Tenm4	UTSW	7	96896052	missense	possibly damaging	0.78
R0164:Tenm4	UTSW	7	96729340	splice site	probably benign
R0277:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0323:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0362:Tenm4	UTSW	7	96772035	nonsense	probably null
R0381:Tenm4	UTSW	7	96905881	missense	probably damaging	1.00
R0420:Tenm4	UTSW	7	96873766	missense	possibly damaging	0.85
R0426:Tenm4	UTSW	7	96777851	missense	probably damaging	1.00
R0513:Tenm4	UTSW	7	96895623	missense	probably benign	0.35
R0624:Tenm4	UTSW	7	96774020	missense	probably damaging	1.00
R0837:Tenm4	UTSW	7	96896275	splice site	probably benign
R1037:Tenm4	UTSW	7	96797481	missense	probably damaging	0.98
R1172:Tenm4	UTSW	7	96848044	missense	probably damaging	1.00
R1422:Tenm4	UTSW	7	96550051	missense	probably damaging	0.99
R1427:Tenm4	UTSW	7	96843048	missense	probably benign	0.42
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1597:Tenm4	UTSW	7	96902989	critical splice donor site	probably null
R1701:Tenm4	UTSW	7	96902889	missense	probably damaging	1.00
R1707:Tenm4	UTSW	7	96888685	missense	probably damaging	1.00
R1809:Tenm4	UTSW	7	96873780	missense	probably benign	0.17
R1812:Tenm4	UTSW	7	96895940	missense	probably damaging	1.00
R1895:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R1933:Tenm4	UTSW	7	96895326	missense	probably damaging	1.00
R1946:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R2108:Tenm4	UTSW	7	96906290	missense	probably damaging	1.00
R2151:Tenm4	UTSW	7	96902847	missense	probably damaging	1.00
R2247:Tenm4	UTSW	7	96906009	missense	probably benign	0.03
R2329:Tenm4	UTSW	7	96895862	missense	probably benign	0.00
R2893:Tenm4	UTSW	7	96894990	missense	probably damaging	1.00
R2990:Tenm4	UTSW	7	96893125	splice site	probably null
R3409:Tenm4	UTSW	7	96895160	missense	probably damaging	1.00
R3410:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3411:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3440:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3441:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3719:Tenm4	UTSW	7	96863563	missense	possibly damaging	0.92
R3772:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R3773:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R4093:Tenm4	UTSW	7	96895772	missense	probably damaging	1.00
R4439:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4441:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4510:Tenm4	UTSW	7	96894863	missense	probably benign
R4511:Tenm4	UTSW	7	96894863	missense	probably benign
R4543:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4645:Tenm4	UTSW	7	96895742	missense	probably damaging	1.00
R4701:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R4707:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4714:Tenm4	UTSW	7	96894924	missense	probably damaging	1.00
R4742:Tenm4	UTSW	7	96797484	missense	probably damaging	0.99
R4784:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4785:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4801:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4802:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4880:Tenm4	UTSW	7	96905818	splice site	probably null
R5036:Tenm4	UTSW	7	96694790	missense	probably damaging	1.00
R5036:Tenm4	UTSW	7	96852561	missense	probably damaging	1.00
R5050:Tenm4	UTSW	7	96895788	missense	probably damaging	1.00
R5103:Tenm4	UTSW	7	96842957	missense	probably damaging	1.00
R5106:Tenm4	UTSW	7	96843149	missense	probably damaging	0.99
R5118:Tenm4	UTSW	7	96893086	missense	probably damaging	1.00
R5272:Tenm4	UTSW	7	96874203	missense	probably damaging	0.98
R5282:Tenm4	UTSW	7	96837331	missense	possibly damaging	0.90
R5403:Tenm4	UTSW	7	96888827	missense	probably damaging	1.00
R5404:Tenm4	UTSW	7	96894680	missense	probably damaging	1.00
R5567:Tenm4	UTSW	7	96896209	nonsense	probably null
R5590:Tenm4	UTSW	7	96797400	missense	possibly damaging	0.73
R5590:Tenm4	UTSW	7	96797401	missense	possibly damaging	0.93
R5597:Tenm4	UTSW	7	96553517	missense	probably benign	0.00
R5782:Tenm4	UTSW	7	96893039	missense	probably benign	0.00
R5861:Tenm4	UTSW	7	96843217	intron	probably benign
R5890:Tenm4	UTSW	7	96902860	missense	probably damaging	1.00
R5930:Tenm4	UTSW	7	96854719	missense	probably damaging	1.00
R5940:Tenm4	UTSW	7	96845895	missense	probably damaging	1.00
R6012:Tenm4	UTSW	7	96522433	intron	probably benign
R6060:Tenm4	UTSW	7	96873711	missense	probably damaging	1.00
R6104:Tenm4	UTSW	7	96837289	missense	probably damaging	0.97
R6283:Tenm4	UTSW	7	96874494	missense	probably benign	0.33
R6333:Tenm4	UTSW	7	96774124	missense	probably damaging	1.00
R6522:Tenm4	UTSW	7	96843044	missense	possibly damaging	0.88
R6616:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6746:Tenm4	UTSW	7	96892860	missense	probably damaging	1.00
R6751:Tenm4	UTSW	7	96845712	missense	possibly damaging	0.95
R6806:Tenm4	UTSW	7	96811959	missense	possibly damaging	0.95
R6807:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6807:Tenm4	UTSW	7	96895271	missense	probably damaging	1.00
R6809:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6810:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6811:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6853:Tenm4	UTSW	7	96837295	missense	possibly damaging	0.94
R6886:Tenm4	UTSW	7	96797392	missense	possibly damaging	0.85
R6920:Tenm4	UTSW	7	96895550	missense	probably damaging	1.00
R6937:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6939:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7011:Tenm4	UTSW	7	96896135	nonsense	probably null
R7033:Tenm4	UTSW	7	96895223	nonsense	probably null
R7040:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7083:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R7239:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96735813	missense	possibly damaging	0.47
R7337:Tenm4	UTSW	7	96874126	missense	probably benign	0.44
R7400:Tenm4	UTSW	7	96694803	missense	probably damaging	0.97
R7407:Tenm4	UTSW	7	96773987	missense	possibly damaging	0.89
R7449:Tenm4	UTSW	7	96874213	missense	possibly damaging	0.65
R7473:Tenm4	UTSW	7	96774146	missense	probably damaging	1.00
R7477:Tenm4	UTSW	7	96845808	missense	probably damaging	0.99
R7489:Tenm4	UTSW	7	96837314	missense	possibly damaging	0.90
R7498:Tenm4	UTSW	7	96848017	missense	probably damaging	1.00
R7562:Tenm4	UTSW	7	96888814	missense	probably damaging	1.00
R7615:Tenm4	UTSW	7	96845926	missense	probably damaging	1.00
R7624:Tenm4	UTSW	7	96895985	missense	possibly damaging	0.95
R7626:Tenm4	UTSW	7	96893014	missense	probably damaging	1.00
R7690:Tenm4	UTSW	7	96863533	missense	probably benign	0.00
R7692:Tenm4	UTSW	7	96895403	missense	probably damaging	1.00
R7748:Tenm4	UTSW	7	96894702	missense	probably damaging	1.00
R7763:Tenm4	UTSW	7	96895692	missense	probably benign	0.38
R7792:Tenm4	UTSW	7	96774014	missense	possibly damaging	0.54
R7855:Tenm4	UTSW	7	96873874	missense	probably damaging	1.00
R7868:Tenm4	UTSW	7	96906380	missense	possibly damaging	0.79
R7878:Tenm4	UTSW	7	96852357	missense	probably damaging	1.00
R7997:Tenm4	UTSW	7	96874305	missense	probably benign	0.44
R8017:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8019:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8054:Tenm4	UTSW	7	96729346	splice site	probably benign
R8061:Tenm4	UTSW	7	96852456	missense	probably damaging	1.00
R8108:Tenm4	UTSW	7	96854728	missense	probably benign	0.39
R8140:Tenm4	UTSW	7	96895176	missense	probably damaging	1.00
R8214:Tenm4	UTSW	7	96895407	missense	probably damaging	1.00
R8258:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8259:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8364:Tenm4	UTSW	7	96772106	critical splice donor site	probably null
R8542:Tenm4	UTSW	7	96811932	missense	probably damaging	0.99
R8669:Tenm4	UTSW	7	96905941	missense	probably benign
R8670:Tenm4	UTSW	7	96905941	missense	probably benign
R8683:Tenm4	UTSW	7	96902857	missense	probably damaging	0.99
R8691:Tenm4	UTSW	7	96905941	missense	probably benign
R8692:Tenm4	UTSW	7	96905941	missense	probably benign
R8714:Tenm4	UTSW	7	96905941	missense	probably benign
R8716:Tenm4	UTSW	7	96905941	missense	probably benign
R8735:Tenm4	UTSW	7	96905941	missense	probably benign
R8736:Tenm4	UTSW	7	96905941	missense	probably benign
R8737:Tenm4	UTSW	7	96905941	missense	probably benign
R8738:Tenm4	UTSW	7	96873840	missense	probably damaging	1.00
R8738:Tenm4	UTSW	7	96905941	missense	probably benign
R8739:Tenm4	UTSW	7	96905941	missense	probably benign
R8776:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8776-TAIL:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8777:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8777-TAIL:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8817:Tenm4	UTSW	7	96874128	missense	probably benign	0.01
R8851:Tenm4	UTSW	7	96852503	missense	probably damaging	1.00
R8913:Tenm4	UTSW	7	96702745	splice site	probably benign
R8977:Tenm4	UTSW	7	96811970	missense	probably damaging	1.00
R9100:Tenm4	UTSW	7	96845854	missense	probably damaging	1.00
R9136:Tenm4	UTSW	7	96823918	missense	possibly damaging	0.69
R9163:Tenm4	UTSW	7	96823873	missense	probably damaging	1.00
R9188:Tenm4	UTSW	7	96772027	missense	probably damaging	1.00
R9195:Tenm4	UTSW	7	96892919	missense	probably damaging	1.00
R9217:Tenm4	UTSW	7	96885439	missense	probably damaging	1.00
R9344:Tenm4	UTSW	7	96896145	missense	probably damaging	1.00
R9414:Tenm4	UTSW	7	96896160	missense	probably benign
R9466:Tenm4	UTSW	7	96550045	missense	possibly damaging	0.79
R9559:Tenm4	UTSW	7	96823849	missense	probably benign
R9626:Tenm4	UTSW	7	96896138	missense	probably damaging	1.00
R9673:Tenm4	UTSW	7	96867989	missense	probably damaging	1.00
R9676:Tenm4	UTSW	7	96895431	missense	probably damaging	1.00
R9678:Tenm4	UTSW	7	96737412	missense	possibly damaging	0.94
R9775:Tenm4	UTSW	7	96906554	missense	possibly damaging	0.92
R9790:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9791:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9803:Tenm4	UTSW	7	96553478	missense	probably damaging	1.00
X0021:Tenm4	UTSW	7	96873909	nonsense	probably null
X0026:Tenm4	UTSW	7	96868087	missense	probably damaging	0.98
X0066:Tenm4	UTSW	7	96848030	missense	probably damaging	1.00
X0066:Tenm4	UTSW	7	96894794	missense	probably damaging	1.00
Z1176:Tenm4	UTSW	7	96905914	missense	probably benign	0.00
Z1177:Tenm4	UTSW	7	96863585	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTTTCATGCATGGCACTTGGC -3'
(R):5'- TAACCCCGTGTAACCAACGG -3'

Sequencing Primer
(F):5'- CATGCATGGCACTTGGCTAGAG -3'
(R):5'- GAGCCACTCACCGGTTTCTG -3'

Posted On

2019-06-26