Incidental Mutation 'R0578:Cachd1'
ID56300
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Namecache domain containing 1
SynonymsVwcd1, B430218L07Rik, 1190007F10Rik
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0578 (G1)
Quality Score154
Status Validated
Chromosome4
Chromosomal Location100776675-101029220 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 100994842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
Predicted Effect probably benign
Transcript: ENSMUST00000030257
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097955
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136430
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100966966 missense probably benign 0.05
IGL01531:Cachd1 APN 4 100953034 missense probably benign 0.02
IGL01705:Cachd1 APN 4 100983539 missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100992872 missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100974128 missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100952097 missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100968098 missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100952085 missense probably damaging 0.98
IGL03084:Cachd1 APN 4 101003088 missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100994737 missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100953205 missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100897703 missense probably damaging 0.99
R0646:Cachd1 UTSW 4 100988221 missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100974876 missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100983301 splice site probably benign
R1156:Cachd1 UTSW 4 100988619 missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100974840 missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100974917 missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100988598 missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100966972 missense probably benign 0.02
R1774:Cachd1 UTSW 4 100964435 missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100967043 missense probably benign 0.02
R1845:Cachd1 UTSW 4 100777358 missense probably benign 0.01
R1869:Cachd1 UTSW 4 100983390 missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100953169 missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100990844 missense probably damaging 1.00
R2082:Cachd1 UTSW 4 101002958 missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100949069 splice site probably benign
R2517:Cachd1 UTSW 4 100980882 intron probably null
R2896:Cachd1 UTSW 4 100970903 missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100974880 nonsense probably null
R3818:Cachd1 UTSW 4 100990865 missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100970888 missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100953130 nonsense probably null
R4791:Cachd1 UTSW 4 100918085 missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100994738 missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100964491 missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100966200 missense possibly damaging 0.94
R5322:Cachd1 UTSW 4 100952122 missense probably damaging 0.98
R5335:Cachd1 UTSW 4 100968085 missense possibly damaging 0.88
R5390:Cachd1 UTSW 4 100981006 missense probably damaging 1.00
R5573:Cachd1 UTSW 4 100974079 missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100865006 missense probably benign 0.31
R5905:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100952019 missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100981031 nonsense probably null
R6367:Cachd1 UTSW 4 101002970 missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100952118 missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100989486 missense probably benign
R6691:Cachd1 UTSW 4 100989486 missense probably benign
R7129:Cachd1 UTSW 4 100918066 missense probably null 0.99
R7187:Cachd1 UTSW 4 100976355 missense possibly damaging 0.95
R7387:Cachd1 UTSW 4 100777178 missense unknown
R7833:Cachd1 UTSW 4 100974815 missense probably benign 0.09
R7838:Cachd1 UTSW 4 100967014 missense possibly damaging 0.71
R7867:Cachd1 UTSW 4 100988562 missense probably damaging 0.97
R7882:Cachd1 UTSW 4 100967047 missense probably benign 0.29
R7916:Cachd1 UTSW 4 100974815 missense probably benign 0.09
R7918:Cachd1 UTSW 4 100974153 splice site probably null
R7921:Cachd1 UTSW 4 100967014 missense possibly damaging 0.71
R7950:Cachd1 UTSW 4 100988562 missense probably damaging 0.97
R7965:Cachd1 UTSW 4 100967047 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTTCGCTGCCTAGACGTTAGCC -3'
(R):5'- TGAAAGCAATCTGTGTGGTCAGGG -3'

Sequencing Primer
(F):5'- CTGGTGCCTGGAGATAAGC -3'
(R):5'- GGCCCTTTAGCTTGACACTTTTC -3'
Posted On2013-07-11