Incidental Mutation 'R7238:Dnah2'
ID 563009
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms 2900022L05Rik, D330014H01Rik, Dnahc2, Dnhd3
MMRRC Submission 045345-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7238 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69311635-69439934 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 69349972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000035539
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108659
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,775,712 (GRCm39) T1634S probably damaging Het
Adgrl1 T A 8: 84,665,693 (GRCm39) M1460K probably damaging Het
Adig T A 2: 158,347,773 (GRCm39) L29Q unknown Het
Adnp T G 2: 168,025,887 (GRCm39) K469N probably damaging Het
Akap3 A G 6: 126,842,200 (GRCm39) D273G probably benign Het
Albfm1 A T 5: 90,727,519 (GRCm39) Y379F probably damaging Het
Ankrd34b T C 13: 92,575,139 (GRCm39) Y124H possibly damaging Het
Ap2b1 T G 11: 83,223,948 (GRCm39) F221C possibly damaging Het
Atp2c2 A G 8: 120,469,160 (GRCm39) I358V possibly damaging Het
BC051665 G A 13: 60,930,536 (GRCm39) T272I probably benign Het
Cdan1 G T 2: 120,560,783 (GRCm39) A262E probably benign Het
Ces1d C T 8: 93,904,763 (GRCm39) V326I probably benign Het
Chd3 T C 11: 69,254,873 (GRCm39) R156G probably benign Het
Clip1 C T 5: 123,751,328 (GRCm39) E818K Het
Col6a4 C T 9: 105,877,519 (GRCm39) V2153M probably damaging Het
Crlf3 T C 11: 79,947,351 (GRCm39) N296D possibly damaging Het
Cstdc6 C T 16: 36,142,193 (GRCm39) G61D probably benign Het
D130052B06Rik A G 11: 33,573,594 (GRCm39) I109V probably benign Het
Dcaf5 G T 12: 80,385,483 (GRCm39) T881K probably benign Het
Dennd4a C A 9: 64,769,238 (GRCm39) T408K probably damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Eif1ad8 A T 12: 87,564,006 (GRCm39) K114* probably null Het
Eif2ak2 C T 17: 79,173,760 (GRCm39) V273I probably benign Het
Elac1 C T 18: 73,872,359 (GRCm39) G212D probably damaging Het
Ercc6l2 A G 13: 64,013,798 (GRCm39) D623G probably damaging Het
Exo1 T C 1: 175,716,413 (GRCm39) F177L probably damaging Het
Fat4 A G 3: 38,944,562 (GRCm39) T1152A probably benign Het
Fbxl12 G T 9: 20,529,709 (GRCm39) probably null Het
Fbxo43 T C 15: 36,151,971 (GRCm39) Y582C probably damaging Het
Fsip2 T A 2: 82,812,484 (GRCm39) N2934K possibly damaging Het
Gna12 A G 5: 140,815,847 (GRCm39) S69P probably damaging Het
Gpatch8 C A 11: 102,369,354 (GRCm39) G1395C probably damaging Het
Gpr137c A G 14: 45,516,148 (GRCm39) Y294C probably damaging Het
Greb1 A G 12: 16,724,673 (GRCm39) S1834P probably damaging Het
Grin2b T C 6: 135,757,249 (GRCm39) D404G probably damaging Het
Hectd2 A T 19: 36,574,478 (GRCm39) N236I probably damaging Het
Hhip C T 8: 80,713,641 (GRCm39) V562I probably benign Het
Hipk2 G T 6: 38,692,992 (GRCm39) T867N probably benign Het
Hmgcl T C 4: 135,689,424 (GRCm39) V294A possibly damaging Het
Hnrnpl T A 7: 28,513,400 (GRCm39) F158I Het
Hspa5 T C 2: 34,662,383 (GRCm39) V17A unknown Het
Hspg2 T C 4: 137,235,704 (GRCm39) V168A probably damaging Het
Idh1 A G 1: 65,205,284 (GRCm39) F227S probably damaging Het
Iigp1c A G 18: 60,379,355 (GRCm39) S297G possibly damaging Het
Immp2l T C 12: 41,160,915 (GRCm39) V71A possibly damaging Het
Iqce G A 5: 140,675,713 (GRCm39) R193* probably null Het
Kcnq5 T C 1: 21,472,526 (GRCm39) D907G probably benign Het
Krt17 T A 11: 100,148,613 (GRCm39) T306S probably benign Het
Lhx3 T C 2: 26,093,009 (GRCm39) D149G probably damaging Het
Lrrc73 G A 17: 46,565,488 (GRCm39) R73H probably damaging Het
Mgat5b T C 11: 116,875,809 (GRCm39) S678P probably benign Het
Mink1 T C 11: 70,502,305 (GRCm39) probably null Het
Mroh5 T G 15: 73,663,278 (GRCm39) probably null Het
Muc5ac T A 7: 141,363,254 (GRCm39) H2188Q unknown Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Musk G A 4: 58,344,312 (GRCm39) G305D probably benign Het
Mx1 A G 16: 97,249,496 (GRCm39) I347T unknown Het
Mybbp1a G T 11: 72,334,338 (GRCm39) V198F probably damaging Het
Mycbp2 A G 14: 103,393,733 (GRCm39) S2943P probably damaging Het
Myo18a G A 11: 77,733,059 (GRCm39) R1363K probably damaging Het
Nav3 T A 10: 109,689,185 (GRCm39) D364V possibly damaging Het
Or13g1 T C 7: 85,955,799 (GRCm39) H174R probably damaging Het
Or14j6 T C 17: 38,215,328 (GRCm39) L297S probably benign Het
Or1e26 A T 11: 73,480,561 (GRCm39) M1K probably null Het
Or1j13 T A 2: 36,369,726 (GRCm39) N139Y possibly damaging Het
Or5k15 T A 16: 58,710,252 (GRCm39) E110D probably damaging Het
Pecr T C 1: 72,298,592 (GRCm39) D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Ppp1cb A T 5: 32,648,376 (GRCm39) T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 (GRCm39) K1084N probably damaging Het
Prdm2 A G 4: 142,862,391 (GRCm39) S300P probably benign Het
Prkg1 C T 19: 30,602,090 (GRCm39) V389I probably damaging Het
Psg25 C T 7: 18,266,127 (GRCm39) probably benign Het
Ptpn6 A G 6: 124,698,821 (GRCm39) S498P possibly damaging Het
Pus3 A G 9: 35,477,965 (GRCm39) H399R probably benign Het
Pus7 T C 5: 23,983,450 (GRCm39) T6A probably benign Het
Rnf169 A G 7: 99,574,954 (GRCm39) V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,128 (GRCm39) probably benign Het
Ryr1 C T 7: 28,794,807 (GRCm39) D1194N probably benign Het
Scn5a T C 9: 119,320,610 (GRCm39) M1490V possibly damaging Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Selenoo T A 15: 88,973,427 (GRCm39) M39K probably benign Het
Septin8 T G 11: 53,427,519 (GRCm39) V246G possibly damaging Het
Serpina3k T A 12: 104,309,367 (GRCm39) N270K probably damaging Het
Setd5 G A 6: 113,098,091 (GRCm39) R710H probably damaging Het
Sirt4 A T 5: 115,621,049 (GRCm39) I41N possibly damaging Het
Slc26a9 T A 1: 131,686,556 (GRCm39) Y425* probably null Het
Slc4a9 A G 18: 36,662,773 (GRCm39) E176G probably benign Het
Speer1m T C 5: 11,970,712 (GRCm39) I127T Het
Spidr A T 16: 15,784,680 (GRCm39) W463R probably benign Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Tmcc1 G A 6: 116,111,198 (GRCm39) Q28* probably null Het
Tmem52b A G 6: 129,493,651 (GRCm39) E88G probably damaging Het
Trpc7 A T 13: 56,974,710 (GRCm39) I402K probably benign Het
Tshz3 T C 7: 36,469,522 (GRCm39) Y504H probably damaging Het
Ttn T C 2: 76,542,549 (GRCm39) E33479G possibly damaging Het
Ttn G A 2: 76,711,672 (GRCm39) R8290C unknown Het
Urb1 T C 16: 90,549,003 (GRCm39) D2235G possibly damaging Het
Usp10 T C 8: 120,668,283 (GRCm39) F195L probably benign Het
Vmn1r31 A T 6: 58,449,858 (GRCm39) F2L Het
Vmn2r109 C T 17: 20,761,336 (GRCm39) V674M probably damaging Het
Vmn2r12 G A 5: 109,245,655 (GRCm39) P26S possibly damaging Het
Vmn2r61 T A 7: 41,916,629 (GRCm39) M414K possibly damaging Het
Yipf3 T C 17: 46,562,585 (GRCm39) V330A probably benign Het
Zic4 A T 9: 91,261,450 (GRCm39) H235L probably benign Het
Zxdc T A 6: 90,346,642 (GRCm39) W16R unknown Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69,383,498 (GRCm39) missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69,385,892 (GRCm39) splice site probably benign
IGL00772:Dnah2 APN 11 69,342,083 (GRCm39) missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69,364,176 (GRCm39) critical splice donor site probably null
IGL00827:Dnah2 APN 11 69,339,283 (GRCm39) missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69,368,918 (GRCm39) missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69,384,010 (GRCm39) missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69,366,432 (GRCm39) missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69,323,790 (GRCm39) missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69,365,017 (GRCm39) splice site probably benign
IGL01480:Dnah2 APN 11 69,349,197 (GRCm39) missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69,406,906 (GRCm39) missense probably benign 0.17
IGL01592:Dnah2 APN 11 69,321,913 (GRCm39) missense probably benign 0.14
IGL01612:Dnah2 APN 11 69,355,889 (GRCm39) splice site probably benign
IGL01667:Dnah2 APN 11 69,435,221 (GRCm39) missense probably benign
IGL01667:Dnah2 APN 11 69,411,767 (GRCm39) missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69,430,269 (GRCm39) missense probably benign
IGL02019:Dnah2 APN 11 69,365,111 (GRCm39) missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69,390,038 (GRCm39) missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69,313,385 (GRCm39) missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69,349,011 (GRCm39) missense probably benign 0.07
IGL02158:Dnah2 APN 11 69,348,949 (GRCm39) missense probably benign
IGL02381:Dnah2 APN 11 69,337,118 (GRCm39) missense probably benign 0.25
IGL02681:Dnah2 APN 11 69,343,759 (GRCm39) missense probably benign 0.40
IGL02957:Dnah2 APN 11 69,339,333 (GRCm39) missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69,409,240 (GRCm39) missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69,412,013 (GRCm39) missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69,327,117 (GRCm39) splice site probably benign
IGL03120:Dnah2 APN 11 69,312,674 (GRCm39) missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69,349,314 (GRCm39) missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69,350,089 (GRCm39) missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69,420,207 (GRCm39) critical splice donor site probably null
IGL03333:Dnah2 APN 11 69,385,949 (GRCm39) missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69,387,403 (GRCm39) missense probably benign 0.13
argyrios UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
Aureus UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
platinum UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
BB005:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69,406,441 (GRCm39) splice site probably null
P0026:Dnah2 UTSW 11 69,355,773 (GRCm39) missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69,311,835 (GRCm39) missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69,326,075 (GRCm39) missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69,420,357 (GRCm39) missense probably benign 0.00
R0386:Dnah2 UTSW 11 69,338,687 (GRCm39) missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69,390,064 (GRCm39) missense probably benign 0.26
R0427:Dnah2 UTSW 11 69,343,705 (GRCm39) missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69,350,114 (GRCm39) missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69,339,368 (GRCm39) missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69,350,027 (GRCm39) missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69,313,952 (GRCm39) missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69,390,020 (GRCm39) missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69,368,509 (GRCm39) missense probably benign 0.07
R0924:Dnah2 UTSW 11 69,312,134 (GRCm39) missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69,339,345 (GRCm39) missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69,338,645 (GRCm39) missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69,337,474 (GRCm39) missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69,390,016 (GRCm39) missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69,406,526 (GRCm39) missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69,341,876 (GRCm39) missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69,411,493 (GRCm39) splice site probably null
R1538:Dnah2 UTSW 11 69,368,028 (GRCm39) missense probably benign 0.17
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1590:Dnah2 UTSW 11 69,412,024 (GRCm39) missense probably benign 0.00
R1590:Dnah2 UTSW 11 69,313,580 (GRCm39) critical splice donor site probably null
R1655:Dnah2 UTSW 11 69,364,680 (GRCm39) missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69,405,517 (GRCm39) missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69,388,715 (GRCm39) missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69,314,369 (GRCm39) missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69,366,400 (GRCm39) missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69,405,630 (GRCm39) missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69,328,712 (GRCm39) missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69,406,578 (GRCm39) missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69,355,756 (GRCm39) missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69,365,151 (GRCm39) missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69,349,184 (GRCm39) critical splice donor site probably null
R2016:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69,415,066 (GRCm39) missense probably benign 0.14
R2077:Dnah2 UTSW 11 69,387,432 (GRCm39) missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69,346,742 (GRCm39) missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69,384,063 (GRCm39) missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2128:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2146:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2147:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2150:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2404:Dnah2 UTSW 11 69,328,047 (GRCm39) missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69,415,032 (GRCm39) nonsense probably null
R2517:Dnah2 UTSW 11 69,407,470 (GRCm39) missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69,321,304 (GRCm39) missense probably benign
R3741:Dnah2 UTSW 11 69,339,295 (GRCm39) missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69,383,476 (GRCm39) splice site probably null
R3872:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69,342,173 (GRCm39) missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69,344,929 (GRCm39) missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69,374,847 (GRCm39) missense probably benign 0.00
R4501:Dnah2 UTSW 11 69,368,485 (GRCm39) missense probably benign
R4515:Dnah2 UTSW 11 69,356,457 (GRCm39) missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69,374,193 (GRCm39) missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69,354,487 (GRCm39) missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69,356,202 (GRCm39) missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69,387,385 (GRCm39) missense probably benign 0.00
R4683:Dnah2 UTSW 11 69,349,768 (GRCm39) missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69,389,358 (GRCm39) missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69,368,903 (GRCm39) missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69,367,514 (GRCm39) missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69,320,183 (GRCm39) missense probably benign 0.00
R4740:Dnah2 UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69,364,697 (GRCm39) missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69,314,031 (GRCm39) missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69,313,416 (GRCm39) missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69,354,474 (GRCm39) missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69,367,517 (GRCm39) missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69,411,973 (GRCm39) missense probably benign 0.00
R4911:Dnah2 UTSW 11 69,389,930 (GRCm39) critical splice donor site probably null
R4954:Dnah2 UTSW 11 69,430,322 (GRCm39) missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69,346,799 (GRCm39) nonsense probably null
R5015:Dnah2 UTSW 11 69,388,708 (GRCm39) missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69,338,992 (GRCm39) missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69,411,599 (GRCm39) missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69,411,759 (GRCm39) missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69,313,362 (GRCm39) missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69,326,710 (GRCm39) missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5208:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5252:Dnah2 UTSW 11 69,420,295 (GRCm39) missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5298:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5299:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5301:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5324:Dnah2 UTSW 11 69,348,819 (GRCm39) missense probably benign 0.07
R5350:Dnah2 UTSW 11 69,406,862 (GRCm39) missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69,312,674 (GRCm39) missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69,391,683 (GRCm39) missense probably benign
R5421:Dnah2 UTSW 11 69,326,462 (GRCm39) missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69,415,209 (GRCm39) missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69,364,177 (GRCm39) critical splice donor site probably null
R5474:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5476:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5477:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5510:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5527:Dnah2 UTSW 11 69,328,014 (GRCm39) nonsense probably null
R5566:Dnah2 UTSW 11 69,407,395 (GRCm39) nonsense probably null
R5587:Dnah2 UTSW 11 69,328,068 (GRCm39) missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5688:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5690:Dnah2 UTSW 11 69,382,370 (GRCm39) missense probably benign 0.15
R5711:Dnah2 UTSW 11 69,326,216 (GRCm39) missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69,321,643 (GRCm39) missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5913:Dnah2 UTSW 11 69,339,256 (GRCm39) missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5960:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,321,974 (GRCm39) missense probably damaging 1.00
R5977:Dnah2 UTSW 11 69,411,707 (GRCm39) missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69,391,665 (GRCm39) missense probably benign
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6050:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6086:Dnah2 UTSW 11 69,406,834 (GRCm39) missense probably benign 0.30
R6115:Dnah2 UTSW 11 69,337,475 (GRCm39) missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69,409,185 (GRCm39) missense probably benign 0.29
R6159:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6159:Dnah2 UTSW 11 69,349,368 (GRCm39) missense probably damaging 1.00
R6163:Dnah2 UTSW 11 69,411,729 (GRCm39) nonsense probably null
R6171:Dnah2 UTSW 11 69,313,868 (GRCm39) missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69,348,238 (GRCm39) missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69,382,467 (GRCm39) missense probably benign 0.25
R6352:Dnah2 UTSW 11 69,339,053 (GRCm39) missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69,349,344 (GRCm39) missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69,430,241 (GRCm39) missense probably benign
R6478:Dnah2 UTSW 11 69,406,836 (GRCm39) missense probably benign 0.01
R6516:Dnah2 UTSW 11 69,356,212 (GRCm39) missense probably benign 0.34
R6538:Dnah2 UTSW 11 69,328,023 (GRCm39) missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69,314,516 (GRCm39) missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69,346,789 (GRCm39) missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69,320,297 (GRCm39) missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69,375,086 (GRCm39) missense probably benign 0.12
R6935:Dnah2 UTSW 11 69,312,567 (GRCm39) missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69,382,373 (GRCm39) nonsense probably null
R7073:Dnah2 UTSW 11 69,321,318 (GRCm39) nonsense probably null
R7111:Dnah2 UTSW 11 69,337,579 (GRCm39) splice site probably null
R7125:Dnah2 UTSW 11 69,327,008 (GRCm39) missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69,382,381 (GRCm39) missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69,439,923 (GRCm39) splice site probably null
R7214:Dnah2 UTSW 11 69,321,935 (GRCm39) missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69,312,222 (GRCm39) missense probably damaging 0.99
R7256:Dnah2 UTSW 11 69,321,920 (GRCm39) missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69,391,643 (GRCm39) missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69,369,623 (GRCm39) missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69,383,631 (GRCm39) missense probably benign 0.25
R7437:Dnah2 UTSW 11 69,389,453 (GRCm39) missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7473:Dnah2 UTSW 11 69,382,484 (GRCm39) missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69,391,622 (GRCm39) missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7615:Dnah2 UTSW 11 69,326,130 (GRCm39) missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69,389,511 (GRCm39) missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69,342,144 (GRCm39) nonsense probably null
R7764:Dnah2 UTSW 11 69,348,984 (GRCm39) missense probably benign 0.29
R7793:Dnah2 UTSW 11 69,386,040 (GRCm39) missense probably benign 0.00
R7819:Dnah2 UTSW 11 69,407,419 (GRCm39) missense probably benign 0.01
R7881:Dnah2 UTSW 11 69,322,064 (GRCm39) missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69,409,254 (GRCm39) missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69,311,974 (GRCm39) critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69,411,660 (GRCm39) missense probably benign
R7928:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69,408,511 (GRCm39) nonsense probably null
R7995:Dnah2 UTSW 11 69,411,563 (GRCm39) missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69,369,649 (GRCm39) missense probably benign 0.00
R8208:Dnah2 UTSW 11 69,411,678 (GRCm39) missense probably benign 0.05
R8215:Dnah2 UTSW 11 69,326,193 (GRCm39) missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69,366,399 (GRCm39) missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69,378,122 (GRCm39) missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69,320,273 (GRCm39) missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69,349,289 (GRCm39) missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69,350,104 (GRCm39) missense probably benign 0.00
R8493:Dnah2 UTSW 11 69,343,804 (GRCm39) missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69,405,523 (GRCm39) missense probably benign 0.23
R8725:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69,384,087 (GRCm39) missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69,356,511 (GRCm39) missense probably benign 0.01
R8876:Dnah2 UTSW 11 69,382,348 (GRCm39) missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69,383,048 (GRCm39) missense probably benign 0.01
R8938:Dnah2 UTSW 11 69,328,754 (GRCm39) missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69,420,247 (GRCm39) missense probably benign
R9085:Dnah2 UTSW 11 69,320,224 (GRCm39) missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69,435,208 (GRCm39) missense probably benign
R9156:Dnah2 UTSW 11 69,313,687 (GRCm39) missense
R9251:Dnah2 UTSW 11 69,406,619 (GRCm39) missense probably damaging 1.00
R9258:Dnah2 UTSW 11 69,368,079 (GRCm39) missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69,409,104 (GRCm39) missense probably benign 0.01
R9318:Dnah2 UTSW 11 69,375,155 (GRCm39) missense probably benign 0.07
R9321:Dnah2 UTSW 11 69,338,939 (GRCm39) critical splice donor site probably null
R9350:Dnah2 UTSW 11 69,384,073 (GRCm39) missense probably benign 0.10
R9358:Dnah2 UTSW 11 69,406,592 (GRCm39) missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69,326,990 (GRCm39) missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69,368,942 (GRCm39) missense probably benign 0.09
R9438:Dnah2 UTSW 11 69,364,220 (GRCm39) missense probably damaging 1.00
R9469:Dnah2 UTSW 11 69,321,896 (GRCm39) missense probably damaging 1.00
R9487:Dnah2 UTSW 11 69,406,617 (GRCm39) missense possibly damaging 0.47
R9495:Dnah2 UTSW 11 69,345,208 (GRCm39) missense possibly damaging 0.89
R9579:Dnah2 UTSW 11 69,368,041 (GRCm39) missense probably damaging 1.00
R9608:Dnah2 UTSW 11 69,344,888 (GRCm39) missense probably null 1.00
R9651:Dnah2 UTSW 11 69,341,824 (GRCm39) critical splice donor site probably null
R9662:Dnah2 UTSW 11 69,343,763 (GRCm39) missense probably benign
RF004:Dnah2 UTSW 11 69,328,013 (GRCm39) missense probably benign 0.24
U24488:Dnah2 UTSW 11 69,374,648 (GRCm39) missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69,339,388 (GRCm39) missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69,321,619 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,312,647 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,407,349 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,407,307 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,389,493 (GRCm39) missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69,377,880 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,341,946 (GRCm39) missense probably benign
Z1177:Dnah2 UTSW 11 69,435,383 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah2 UTSW 11 69,354,279 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CACTGTGTCCTAAGAGACAAGTAC -3'
(R):5'- GCCAATTCGCCACTCTGAAC -3'

Sequencing Primer
(F):5'- AGTACACAAGTTGGGTCACC -3'
(R):5'- AATTCGCCACTCTGAACTGCTG -3'
Posted On 2019-06-26