Incidental Mutation 'R7238:Olfr385'
ID563012
Institutional Source Beutler Lab
Gene Symbol Olfr385
Ensembl Gene ENSMUSG00000095095
Gene Nameolfactory receptor 385
SynonymsMOR135-3, GA_x6K02T2P1NL-3760313-3759375
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7238 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73588302-73593008 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 73589735 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
Predicted Effect probably null
Transcript: ENSMUST00000071553
AA Change: M1K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215689
AA Change: M1K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.7965 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,069,951 T1634S probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Col6a4 C T 9: 106,000,320 V2153M probably damaging Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Immp2l T C 12: 41,110,916 V71A possibly damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Lrrc73 G A 17: 46,254,562 R73H probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mx1 A G 16: 97,448,296 I347T unknown Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Ptpn6 A G 6: 124,721,858 S498P possibly damaging Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Selenoo T A 15: 89,089,224 M39K probably benign Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in Olfr385
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Olfr385 APN 11 73589383 missense probably benign 0.34
IGL02045:Olfr385 APN 11 73589232 missense probably damaging 1.00
IGL02324:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02328:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02562:Olfr385 APN 11 73589411 missense probably benign
IGL02715:Olfr385 APN 11 73589121 missense probably benign 0.00
IGL03182:Olfr385 APN 11 73589442 missense probably benign 0.04
IGL03048:Olfr385 UTSW 11 73589005 missense possibly damaging 0.56
R0346:Olfr385 UTSW 11 73589457 missense probably damaging 1.00
R0675:Olfr385 UTSW 11 73589252 missense probably damaging 1.00
R0751:Olfr385 UTSW 11 73589144 missense probably benign 0.02
R1220:Olfr385 UTSW 11 73589377 nonsense probably null
R1389:Olfr385 UTSW 11 73589543 missense possibly damaging 0.88
R1484:Olfr385 UTSW 11 73589361 missense possibly damaging 0.91
R1619:Olfr385 UTSW 11 73589292 missense probably damaging 1.00
R2290:Olfr385 UTSW 11 73588919 missense probably benign 0.37
R3713:Olfr385 UTSW 11 73588905 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589368 nonsense probably null
R3782:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3782:Olfr385 UTSW 11 73589368 nonsense probably null
R4402:Olfr385 UTSW 11 73589255 missense probably benign 0.02
R4721:Olfr385 UTSW 11 73589447 missense probably damaging 1.00
R5157:Olfr385 UTSW 11 73589723 missense probably damaging 1.00
R5995:Olfr385 UTSW 11 73589250 missense probably benign
R6373:Olfr385 UTSW 11 73588898 missense probably benign 0.42
R6658:Olfr385 UTSW 11 73589048 missense probably damaging 0.99
R7046:Olfr385 UTSW 11 73589732 missense probably benign
R7096:Olfr385 UTSW 11 73589637 missense probably benign 0.03
R7537:Olfr385 UTSW 11 73589268 missense probably benign 0.04
R7548:Olfr385 UTSW 11 73588976 missense possibly damaging 0.56
R7888:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
R7971:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAACTTGGGCATTGTGAC -3'
(R):5'- AACATCCAAATGTCTACAAAAGGGG -3'

Sequencing Primer
(F):5'- CAACTTGGGCATTGTGACAGAGG -3'
(R):5'- ATGAGTTAGACCCACTGC -3'
Posted On2019-06-26