Mutagenetix > Incidental Mutation

Incidental Mutation 'R7238:Greb1'

563019

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7238 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16674672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1834 (S1834P)

Ref Sequence

ENSEMBL: ENSMUSP00000044454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

AlphaFold

Q3UHK3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048064
AA Change: S1834P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: S1834P

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159120
AA Change: S1806P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: S1806P

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162112
AA Change: S1834P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: S1834P

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

97% (104/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,069,951	T1634S	probably damaging	Het
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
4933402N22Rik	T	C	5: 11,920,745	I127T		Het
5830473C10Rik	A	T	5: 90,579,660	Y379F	probably damaging	Het
Adgrl1	T	A	8: 83,939,064	M1460K	probably damaging	Het
Adig	T	A	2: 158,505,853	L29Q	unknown	Het
Adnp	T	G	2: 168,183,967	K469N	probably damaging	Het
Akap3	A	G	6: 126,865,237	D273G	probably benign	Het
Ankrd34b	T	C	13: 92,438,631	Y124H	possibly damaging	Het
Ap2b1	T	G	11: 83,333,122	F221C	possibly damaging	Het
Atp2c2	A	G	8: 119,742,421	I358V	possibly damaging	Het
BC051665	G	A	13: 60,782,722	T272I	probably benign	Het
BC117090	C	T	16: 36,321,831	G61D	probably benign	Het
Cdan1	G	T	2: 120,730,302	A262E	probably benign	Het
Ces1d	C	T	8: 93,178,135	V326I	probably benign	Het
Chd3	T	C	11: 69,364,047	R156G	probably benign	Het
Clip1	C	T	5: 123,613,265	E818K		Het
Col6a4	C	T	9: 106,000,320	V2153M	probably damaging	Het
Crlf3	T	C	11: 80,056,525	N296D	possibly damaging	Het
D130052B06Rik	A	G	11: 33,623,594	I109V	probably benign	Het
Dcaf5	G	T	12: 80,338,709	T881K	probably benign	Het
Dennd4a	C	A	9: 64,861,956	T408K	probably damaging	Het
Dnah2	A	G	11: 69,459,146		probably null	Het
Eif2ak2	C	T	17: 78,866,331	V273I	probably benign	Het
Elac1	C	T	18: 73,739,288	G212D	probably damaging	Het
Ercc6l2	A	G	13: 63,865,984	D623G	probably damaging	Het
Exo1	T	C	1: 175,888,847	F177L	probably damaging	Het
Fat4	A	G	3: 38,890,413	T1152A	probably benign	Het
Fbxl12	G	T	9: 20,618,413		probably null	Het
Fbxo43	T	C	15: 36,151,825	Y582C	probably damaging	Het
Fsip2	T	A	2: 82,982,140	N2934K	possibly damaging	Het
Gm4951	A	G	18: 60,246,283	S297G	possibly damaging	Het
Gm8300	A	T	12: 87,517,236	K114*	probably null	Het
Gna12	A	G	5: 140,830,092	S69P	probably damaging	Het
Gpatch8	C	A	11: 102,478,528	G1395C	probably damaging	Het
Gpr137c	A	G	14: 45,278,691	Y294C	probably damaging	Het
Grin2b	T	C	6: 135,780,251	D404G	probably damaging	Het
Hectd2	A	T	19: 36,597,078	N236I	probably damaging	Het
Hhip	C	T	8: 79,987,012	V562I	probably benign	Het
Hipk2	G	T	6: 38,716,057	T867N	probably benign	Het
Hmgcl	T	C	4: 135,962,113	V294A	possibly damaging	Het
Hnrnpl	T	A	7: 28,813,975	F158I		Het
Hspa5	T	C	2: 34,772,371	V17A	unknown	Het
Hspg2	T	C	4: 137,508,393	V168A	probably damaging	Het
Idh1	A	G	1: 65,166,125	F227S	probably damaging	Het
Immp2l	T	C	12: 41,110,916	V71A	possibly damaging	Het
Iqce	G	A	5: 140,689,958	R193*	probably null	Het
Kcnq5	T	C	1: 21,402,302	D907G	probably benign	Het
Krt17	T	A	11: 100,257,787	T306S	probably benign	Het
Lhx3	T	C	2: 26,202,997	D149G	probably damaging	Het
Lrrc73	G	A	17: 46,254,562	R73H	probably damaging	Het
Mgat5b	T	C	11: 116,984,983	S678P	probably benign	Het
Mink1	T	C	11: 70,611,479		probably null	Het
Mroh5	T	G	15: 73,791,429		probably null	Het
Muc5ac	T	A	7: 141,809,517	H2188Q	unknown	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Musk	G	A	4: 58,344,312	G305D	probably benign	Het
Mx1	A	G	16: 97,448,296	I347T	unknown	Het
Mybbp1a	G	T	11: 72,443,512	V198F	probably damaging	Het
Mycbp2	A	G	14: 103,156,297	S2943P	probably damaging	Het
Myo18a	G	A	11: 77,842,233	R1363K	probably damaging	Het
Nav3	T	A	10: 109,853,324	D364V	possibly damaging	Het
Olfr127	T	C	17: 37,904,437	L297S	probably benign	Het
Olfr178	T	A	16: 58,889,889	E110D	probably damaging	Het
Olfr309	T	C	7: 86,306,591	H174R	probably damaging	Het
Olfr341	T	A	2: 36,479,714	N139Y	possibly damaging	Het
Olfr385	A	T	11: 73,589,735	M1K	probably null	Het
Pecr	T	C	1: 72,259,433	D276G	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Ppp1cb	A	T	5: 32,491,032	T320S	probably benign	Het
Ppp1r9a	G	T	6: 5,159,716	K1084N	probably damaging	Het
Prdm2	A	G	4: 143,135,821	S300P	probably benign	Het
Prkg1	C	T	19: 30,624,690	V389I	probably damaging	Het
Psg25	C	T	7: 18,532,202		probably benign	Het
Ptpn6	A	G	6: 124,721,858	S498P	possibly damaging	Het
Pus3	A	G	9: 35,566,669	H399R	probably benign	Het
Pus7	T	C	5: 23,778,452	T6A	probably benign	Het
Rnf169	A	G	7: 99,925,747	V547A	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,921		probably benign	Het
Ryr1	C	T	7: 29,095,382	D1194N	probably benign	Het
Scn5a	T	C	9: 119,491,544	M1490V	possibly damaging	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Selenoo	T	A	15: 89,089,224	M39K	probably benign	Het
Sept8	T	G	11: 53,536,692	V246G	possibly damaging	Het
Serpina3k	T	A	12: 104,343,108	N270K	probably damaging	Het
Setd5	G	A	6: 113,121,130	R710H	probably damaging	Het
Sirt4	A	T	5: 115,482,990	I41N	possibly damaging	Het
Slc26a9	T	A	1: 131,758,818	Y425*	probably null	Het
Slc4a9	A	G	18: 36,529,720	E176G	probably benign	Het
Spidr	A	T	16: 15,966,816	W463R	probably benign	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmcc1	G	A	6: 116,134,237	Q28*	probably null	Het
Tmem52b	A	G	6: 129,516,688	E88G	probably damaging	Het
Trpc7	A	T	13: 56,826,897	I402K	probably benign	Het
Tshz3	T	C	7: 36,770,097	Y504H	probably damaging	Het
Ttn	T	C	2: 76,712,205	E33479G	possibly damaging	Het
Ttn	G	A	2: 76,881,328	R8290C	unknown	Het
Urb1	T	C	16: 90,752,115	D2235G	possibly damaging	Het
Usp10	T	C	8: 119,941,544	F195L	probably benign	Het
Vmn1r31	A	T	6: 58,472,873	F2L		Het
Vmn2r109	C	T	17: 20,541,074	V674M	probably damaging	Het
Vmn2r12	G	A	5: 109,097,789	P26S	possibly damaging	Het
Vmn2r61	T	A	7: 42,267,205	M414K	possibly damaging	Het
Yipf3	T	C	17: 46,251,659	V330A	probably benign	Het
Zic4	A	T	9: 91,379,397	H235L	probably benign	Het
Zxdc	T	A	6: 90,369,660	W16R	unknown	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
begraben	UTSW	12	16684373	missense	possibly damaging	0.51
Eared	UTSW	12	16673863	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
pied_billed	UTSW	12	16724857	missense	possibly damaging	0.79
rednecked	UTSW	12	16682152	missense	probably damaging	0.99
G1patch:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R7937:Greb1	UTSW	12	16716669	missense	probably damaging	0.99
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
R8259:Greb1	UTSW	12	16724924	nonsense	probably null
R8553:Greb1	UTSW	12	16723327	missense	probably benign	0.00
R8559:Greb1	UTSW	12	16696435	missense	probably damaging	1.00
R8690:Greb1	UTSW	12	16696547	missense	probably benign	0.03
R8830:Greb1	UTSW	12	16688519	missense	probably benign	0.35
R8911:Greb1	UTSW	12	16690902	missense	possibly damaging	0.84
R8963:Greb1	UTSW	12	16724884	missense	probably damaging	1.00
R8986:Greb1	UTSW	12	16684456	missense	probably damaging	0.99
R9013:Greb1	UTSW	12	16739969	missense	probably damaging	1.00
R9279:Greb1	UTSW	12	16682152	missense	probably damaging	0.99
R9360:Greb1	UTSW	12	16740036	missense	probably damaging	1.00
R9563:Greb1	UTSW	12	16724823	missense	probably benign	0.06
R9616:Greb1	UTSW	12	16740037	missense	probably damaging	1.00
R9627:Greb1	UTSW	12	16706166	missense	probably damaging	1.00
R9731:Greb1	UTSW	12	16688597	missense	probably damaging	1.00
R9761:Greb1	UTSW	12	16701274	missense	probably benign	0.05
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACAGGTCAATGTCAGGA -3'
(R):5'- CATGCAAGTGAAGCTAGCTG -3'

Sequencing Primer
(F):5'- CATGAGCGTGTGCAAATTTCC -3'
(R):5'- AGACATGTGTGACCTCACCTG -3'

Posted On

2019-06-26