Incidental Mutation 'R7238:Greb1'
ID 563019
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
MMRRC Submission 045345-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7238 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 16720616-16850887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16724673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1834 (S1834P)
Ref Sequence ENSEMBL: ENSMUSP00000044454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: S1834P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: S1834P

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159120
AA Change: S1806P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: S1806P

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: S1834P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: S1834P

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,775,712 (GRCm39) T1634S probably damaging Het
Adgrl1 T A 8: 84,665,693 (GRCm39) M1460K probably damaging Het
Adig T A 2: 158,347,773 (GRCm39) L29Q unknown Het
Adnp T G 2: 168,025,887 (GRCm39) K469N probably damaging Het
Akap3 A G 6: 126,842,200 (GRCm39) D273G probably benign Het
Albfm1 A T 5: 90,727,519 (GRCm39) Y379F probably damaging Het
Ankrd34b T C 13: 92,575,139 (GRCm39) Y124H possibly damaging Het
Ap2b1 T G 11: 83,223,948 (GRCm39) F221C possibly damaging Het
Atp2c2 A G 8: 120,469,160 (GRCm39) I358V possibly damaging Het
BC051665 G A 13: 60,930,536 (GRCm39) T272I probably benign Het
Cdan1 G T 2: 120,560,783 (GRCm39) A262E probably benign Het
Ces1d C T 8: 93,904,763 (GRCm39) V326I probably benign Het
Chd3 T C 11: 69,254,873 (GRCm39) R156G probably benign Het
Clip1 C T 5: 123,751,328 (GRCm39) E818K Het
Col6a4 C T 9: 105,877,519 (GRCm39) V2153M probably damaging Het
Crlf3 T C 11: 79,947,351 (GRCm39) N296D possibly damaging Het
Cstdc6 C T 16: 36,142,193 (GRCm39) G61D probably benign Het
D130052B06Rik A G 11: 33,573,594 (GRCm39) I109V probably benign Het
Dcaf5 G T 12: 80,385,483 (GRCm39) T881K probably benign Het
Dennd4a C A 9: 64,769,238 (GRCm39) T408K probably damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah2 A G 11: 69,349,972 (GRCm39) probably null Het
Eif1ad8 A T 12: 87,564,006 (GRCm39) K114* probably null Het
Eif2ak2 C T 17: 79,173,760 (GRCm39) V273I probably benign Het
Elac1 C T 18: 73,872,359 (GRCm39) G212D probably damaging Het
Ercc6l2 A G 13: 64,013,798 (GRCm39) D623G probably damaging Het
Exo1 T C 1: 175,716,413 (GRCm39) F177L probably damaging Het
Fat4 A G 3: 38,944,562 (GRCm39) T1152A probably benign Het
Fbxl12 G T 9: 20,529,709 (GRCm39) probably null Het
Fbxo43 T C 15: 36,151,971 (GRCm39) Y582C probably damaging Het
Fsip2 T A 2: 82,812,484 (GRCm39) N2934K possibly damaging Het
Gna12 A G 5: 140,815,847 (GRCm39) S69P probably damaging Het
Gpatch8 C A 11: 102,369,354 (GRCm39) G1395C probably damaging Het
Gpr137c A G 14: 45,516,148 (GRCm39) Y294C probably damaging Het
Grin2b T C 6: 135,757,249 (GRCm39) D404G probably damaging Het
Hectd2 A T 19: 36,574,478 (GRCm39) N236I probably damaging Het
Hhip C T 8: 80,713,641 (GRCm39) V562I probably benign Het
Hipk2 G T 6: 38,692,992 (GRCm39) T867N probably benign Het
Hmgcl T C 4: 135,689,424 (GRCm39) V294A possibly damaging Het
Hnrnpl T A 7: 28,513,400 (GRCm39) F158I Het
Hspa5 T C 2: 34,662,383 (GRCm39) V17A unknown Het
Hspg2 T C 4: 137,235,704 (GRCm39) V168A probably damaging Het
Idh1 A G 1: 65,205,284 (GRCm39) F227S probably damaging Het
Iigp1c A G 18: 60,379,355 (GRCm39) S297G possibly damaging Het
Immp2l T C 12: 41,160,915 (GRCm39) V71A possibly damaging Het
Iqce G A 5: 140,675,713 (GRCm39) R193* probably null Het
Kcnq5 T C 1: 21,472,526 (GRCm39) D907G probably benign Het
Krt17 T A 11: 100,148,613 (GRCm39) T306S probably benign Het
Lhx3 T C 2: 26,093,009 (GRCm39) D149G probably damaging Het
Lrrc73 G A 17: 46,565,488 (GRCm39) R73H probably damaging Het
Mgat5b T C 11: 116,875,809 (GRCm39) S678P probably benign Het
Mink1 T C 11: 70,502,305 (GRCm39) probably null Het
Mroh5 T G 15: 73,663,278 (GRCm39) probably null Het
Muc5ac T A 7: 141,363,254 (GRCm39) H2188Q unknown Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Musk G A 4: 58,344,312 (GRCm39) G305D probably benign Het
Mx1 A G 16: 97,249,496 (GRCm39) I347T unknown Het
Mybbp1a G T 11: 72,334,338 (GRCm39) V198F probably damaging Het
Mycbp2 A G 14: 103,393,733 (GRCm39) S2943P probably damaging Het
Myo18a G A 11: 77,733,059 (GRCm39) R1363K probably damaging Het
Nav3 T A 10: 109,689,185 (GRCm39) D364V possibly damaging Het
Or13g1 T C 7: 85,955,799 (GRCm39) H174R probably damaging Het
Or14j6 T C 17: 38,215,328 (GRCm39) L297S probably benign Het
Or1e26 A T 11: 73,480,561 (GRCm39) M1K probably null Het
Or1j13 T A 2: 36,369,726 (GRCm39) N139Y possibly damaging Het
Or5k15 T A 16: 58,710,252 (GRCm39) E110D probably damaging Het
Pecr T C 1: 72,298,592 (GRCm39) D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Ppp1cb A T 5: 32,648,376 (GRCm39) T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 (GRCm39) K1084N probably damaging Het
Prdm2 A G 4: 142,862,391 (GRCm39) S300P probably benign Het
Prkg1 C T 19: 30,602,090 (GRCm39) V389I probably damaging Het
Psg25 C T 7: 18,266,127 (GRCm39) probably benign Het
Ptpn6 A G 6: 124,698,821 (GRCm39) S498P possibly damaging Het
Pus3 A G 9: 35,477,965 (GRCm39) H399R probably benign Het
Pus7 T C 5: 23,983,450 (GRCm39) T6A probably benign Het
Rnf169 A G 7: 99,574,954 (GRCm39) V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,128 (GRCm39) probably benign Het
Ryr1 C T 7: 28,794,807 (GRCm39) D1194N probably benign Het
Scn5a T C 9: 119,320,610 (GRCm39) M1490V possibly damaging Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Selenoo T A 15: 88,973,427 (GRCm39) M39K probably benign Het
Septin8 T G 11: 53,427,519 (GRCm39) V246G possibly damaging Het
Serpina3k T A 12: 104,309,367 (GRCm39) N270K probably damaging Het
Setd5 G A 6: 113,098,091 (GRCm39) R710H probably damaging Het
Sirt4 A T 5: 115,621,049 (GRCm39) I41N possibly damaging Het
Slc26a9 T A 1: 131,686,556 (GRCm39) Y425* probably null Het
Slc4a9 A G 18: 36,662,773 (GRCm39) E176G probably benign Het
Speer1m T C 5: 11,970,712 (GRCm39) I127T Het
Spidr A T 16: 15,784,680 (GRCm39) W463R probably benign Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Tmcc1 G A 6: 116,111,198 (GRCm39) Q28* probably null Het
Tmem52b A G 6: 129,493,651 (GRCm39) E88G probably damaging Het
Trpc7 A T 13: 56,974,710 (GRCm39) I402K probably benign Het
Tshz3 T C 7: 36,469,522 (GRCm39) Y504H probably damaging Het
Ttn T C 2: 76,542,549 (GRCm39) E33479G possibly damaging Het
Ttn G A 2: 76,711,672 (GRCm39) R8290C unknown Het
Urb1 T C 16: 90,549,003 (GRCm39) D2235G possibly damaging Het
Usp10 T C 8: 120,668,283 (GRCm39) F195L probably benign Het
Vmn1r31 A T 6: 58,449,858 (GRCm39) F2L Het
Vmn2r109 C T 17: 20,761,336 (GRCm39) V674M probably damaging Het
Vmn2r12 G A 5: 109,245,655 (GRCm39) P26S possibly damaging Het
Vmn2r61 T A 7: 41,916,629 (GRCm39) M414K possibly damaging Het
Yipf3 T C 17: 46,562,585 (GRCm39) V330A probably benign Het
Zic4 A T 9: 91,261,450 (GRCm39) H235L probably benign Het
Zxdc T A 6: 90,346,642 (GRCm39) W16R unknown Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16,761,962 (GRCm39) missense probably damaging 1.00
IGL01316:Greb1 APN 12 16,748,587 (GRCm39) missense probably benign 0.04
IGL01464:Greb1 APN 12 16,764,827 (GRCm39) missense probably damaging 0.99
IGL01474:Greb1 APN 12 16,734,502 (GRCm39) missense probably benign
IGL01522:Greb1 APN 12 16,751,202 (GRCm39) missense probably damaging 1.00
IGL01824:Greb1 APN 12 16,761,717 (GRCm39) nonsense probably null
IGL01837:Greb1 APN 12 16,734,452 (GRCm39) missense probably benign 0.19
IGL01991:Greb1 APN 12 16,749,682 (GRCm39) missense probably damaging 1.00
IGL01996:Greb1 APN 12 16,740,846 (GRCm39) missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16,756,233 (GRCm39) missense probably damaging 1.00
IGL02267:Greb1 APN 12 16,767,209 (GRCm39) missense probably benign 0.00
IGL02512:Greb1 APN 12 16,742,713 (GRCm39) missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16,756,296 (GRCm39) splice site probably benign
IGL02613:Greb1 APN 12 16,789,889 (GRCm39) critical splice donor site probably null
IGL02648:Greb1 APN 12 16,758,683 (GRCm39) missense probably damaging 1.00
IGL02679:Greb1 APN 12 16,758,724 (GRCm39) missense probably damaging 1.00
begraben UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
Eared UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
Humpback UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
pied_billed UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
rednecked UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16,783,332 (GRCm39) missense probably damaging 1.00
R0083:Greb1 UTSW 12 16,746,452 (GRCm39) missense probably benign
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0220:Greb1 UTSW 12 16,732,287 (GRCm39) missense probably damaging 1.00
R0245:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0540:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0547:Greb1 UTSW 12 16,773,412 (GRCm39) missense probably benign
R0563:Greb1 UTSW 12 16,730,268 (GRCm39) missense probably benign 0.23
R0607:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0610:Greb1 UTSW 12 16,746,443 (GRCm39) missense probably benign
R0652:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0659:Greb1 UTSW 12 16,730,213 (GRCm39) missense probably damaging 0.99
R0945:Greb1 UTSW 12 16,723,803 (GRCm39) missense probably benign 0.31
R1055:Greb1 UTSW 12 16,732,252 (GRCm39) missense probably damaging 0.98
R1445:Greb1 UTSW 12 16,757,852 (GRCm39) missense probably damaging 1.00
R1471:Greb1 UTSW 12 16,761,775 (GRCm39) missense probably damaging 0.97
R1503:Greb1 UTSW 12 16,774,820 (GRCm39) nonsense probably null
R1566:Greb1 UTSW 12 16,761,829 (GRCm39) missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
R1623:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R1751:Greb1 UTSW 12 16,773,439 (GRCm39) splice site probably benign
R1778:Greb1 UTSW 12 16,740,895 (GRCm39) missense probably benign
R1842:Greb1 UTSW 12 16,746,244 (GRCm39) missense probably damaging 1.00
R2040:Greb1 UTSW 12 16,752,651 (GRCm39) missense probably damaging 1.00
R2153:Greb1 UTSW 12 16,749,533 (GRCm39) missense probably damaging 1.00
R2178:Greb1 UTSW 12 16,746,388 (GRCm39) missense probably damaging 1.00
R2194:Greb1 UTSW 12 16,740,909 (GRCm39) missense probably benign 0.08
R2248:Greb1 UTSW 12 16,730,379 (GRCm39) missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16,764,954 (GRCm39) missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16,774,923 (GRCm39) missense probably damaging 1.00
R2860:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2861:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2862:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2866:Greb1 UTSW 12 16,749,551 (GRCm39) missense probably damaging 1.00
R2890:Greb1 UTSW 12 16,754,479 (GRCm39) missense probably damaging 1.00
R3056:Greb1 UTSW 12 16,738,592 (GRCm39) missense probably damaging 0.96
R3863:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3864:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3956:Greb1 UTSW 12 16,732,300 (GRCm39) missense probably damaging 1.00
R4493:Greb1 UTSW 12 16,748,611 (GRCm39) missense probably benign 0.14
R4548:Greb1 UTSW 12 16,749,676 (GRCm39) missense probably damaging 1.00
R4683:Greb1 UTSW 12 16,761,774 (GRCm39) missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16,746,329 (GRCm39) missense probably damaging 1.00
R4770:Greb1 UTSW 12 16,731,357 (GRCm39) missense probably benign 0.03
R4838:Greb1 UTSW 12 16,734,361 (GRCm39) critical splice donor site probably null
R4925:Greb1 UTSW 12 16,731,472 (GRCm39) missense probably damaging 1.00
R4982:Greb1 UTSW 12 16,774,762 (GRCm39) missense probably damaging 0.98
R5009:Greb1 UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16,758,023 (GRCm39) intron probably benign
R5213:Greb1 UTSW 12 16,764,791 (GRCm39) nonsense probably null
R5310:Greb1 UTSW 12 16,766,760 (GRCm39) missense probably benign 0.09
R5353:Greb1 UTSW 12 16,738,567 (GRCm39) nonsense probably null
R5544:Greb1 UTSW 12 16,723,797 (GRCm39) missense probably damaging 1.00
R5605:Greb1 UTSW 12 16,758,727 (GRCm39) missense probably damaging 0.96
R5708:Greb1 UTSW 12 16,723,843 (GRCm39) missense probably benign 0.11
R5837:Greb1 UTSW 12 16,738,586 (GRCm39) missense probably damaging 1.00
R5890:Greb1 UTSW 12 16,783,422 (GRCm39) missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16,767,259 (GRCm39) missense probably damaging 1.00
R6049:Greb1 UTSW 12 16,731,395 (GRCm39) missense probably damaging 0.99
R6093:Greb1 UTSW 12 16,734,487 (GRCm39) missense probably benign
R6120:Greb1 UTSW 12 16,758,622 (GRCm39) missense probably damaging 0.99
R6175:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R6247:Greb1 UTSW 12 16,766,676 (GRCm39) missense probably damaging 1.00
R6274:Greb1 UTSW 12 16,785,152 (GRCm39) missense probably damaging 0.97
R6376:Greb1 UTSW 12 16,749,580 (GRCm39) missense probably damaging 0.97
R6523:Greb1 UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16,760,384 (GRCm39) missense probably benign 0.00
R6602:Greb1 UTSW 12 16,759,441 (GRCm39) missense probably benign 0.44
R6621:Greb1 UTSW 12 16,742,718 (GRCm39) missense probably damaging 1.00
R6645:Greb1 UTSW 12 16,748,580 (GRCm39) missense probably benign 0.07
R6725:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
R6750:Greb1 UTSW 12 16,738,584 (GRCm39) missense probably benign 0.05
R6863:Greb1 UTSW 12 16,734,421 (GRCm39) missense probably damaging 1.00
R6914:Greb1 UTSW 12 16,757,903 (GRCm39) missense probably damaging 0.97
R6996:Greb1 UTSW 12 16,773,355 (GRCm39) missense probably benign 0.00
R7083:Greb1 UTSW 12 16,773,315 (GRCm39) missense probably benign
R7147:Greb1 UTSW 12 16,783,428 (GRCm39) missense probably damaging 1.00
R7290:Greb1 UTSW 12 16,761,739 (GRCm39) missense probably damaging 1.00
R7358:Greb1 UTSW 12 16,774,882 (GRCm39) missense probably damaging 1.00
R7395:Greb1 UTSW 12 16,759,431 (GRCm39) critical splice donor site probably null
R7526:Greb1 UTSW 12 16,766,766 (GRCm39) missense probably benign 0.00
R7530:Greb1 UTSW 12 16,767,207 (GRCm39) missense probably benign 0.02
R7536:Greb1 UTSW 12 16,732,186 (GRCm39) missense probably damaging 1.00
R7643:Greb1 UTSW 12 16,761,997 (GRCm39) missense probably damaging 0.99
R7732:Greb1 UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
R7740:Greb1 UTSW 12 16,790,122 (GRCm39) start gained probably benign
R7747:Greb1 UTSW 12 16,724,796 (GRCm39) missense probably benign 0.01
R7760:Greb1 UTSW 12 16,773,417 (GRCm39) missense probably benign
R7937:Greb1 UTSW 12 16,766,670 (GRCm39) missense probably damaging 0.99
R8043:Greb1 UTSW 12 16,761,790 (GRCm39) missense probably damaging 1.00
R8259:Greb1 UTSW 12 16,774,925 (GRCm39) nonsense probably null
R8553:Greb1 UTSW 12 16,773,328 (GRCm39) missense probably benign 0.00
R8559:Greb1 UTSW 12 16,746,436 (GRCm39) missense probably damaging 1.00
R8690:Greb1 UTSW 12 16,746,548 (GRCm39) missense probably benign 0.03
R8830:Greb1 UTSW 12 16,738,520 (GRCm39) missense probably benign 0.35
R8911:Greb1 UTSW 12 16,740,903 (GRCm39) missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16,774,885 (GRCm39) missense probably damaging 1.00
R8986:Greb1 UTSW 12 16,734,457 (GRCm39) missense probably damaging 0.99
R9013:Greb1 UTSW 12 16,789,970 (GRCm39) missense probably damaging 1.00
R9279:Greb1 UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
R9360:Greb1 UTSW 12 16,790,037 (GRCm39) missense probably damaging 1.00
R9563:Greb1 UTSW 12 16,774,824 (GRCm39) missense probably benign 0.06
R9616:Greb1 UTSW 12 16,790,038 (GRCm39) missense probably damaging 1.00
R9627:Greb1 UTSW 12 16,756,167 (GRCm39) missense probably damaging 1.00
R9731:Greb1 UTSW 12 16,738,598 (GRCm39) missense probably damaging 1.00
R9761:Greb1 UTSW 12 16,751,275 (GRCm39) missense probably benign 0.05
Z1176:Greb1 UTSW 12 16,746,757 (GRCm39) missense probably benign 0.00
Z1177:Greb1 UTSW 12 16,752,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAGGTCAATGTCAGGA -3'
(R):5'- CATGCAAGTGAAGCTAGCTG -3'

Sequencing Primer
(F):5'- CATGAGCGTGTGCAAATTTCC -3'
(R):5'- AGACATGTGTGACCTCACCTG -3'
Posted On 2019-06-26