Incidental Mutation 'R7238:Immp2l'
ID563020
Institutional Source Beutler Lab
Gene Symbol Immp2l
Ensembl Gene ENSMUSG00000056899
Gene NameIMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
SynonymsIMP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7238 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location41024090-41955588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41110916 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 71 (V71A)
Ref Sequence ENSEMBL: ENSMUSP00000079055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080160] [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080160
AA Change: V71A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079055
Gene: ENSMUSG00000056899
AA Change: V71A

DomainStartEndE-ValueType
SCOP:d1b12a_ 33 77 3e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132121
AA Change: V71A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899
AA Change: V71A

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134965
AA Change: V71A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899
AA Change: V71A

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in processing the signal peptide sequences used to direct mitochondrial proteins to the mitochondria. The encoded protein resides in the mitochondria and is one of the necessary proteins for the catalytic activity of the mitochondrial inner membrane peptidase (IMP) complex. Two variants that encode the same protein have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced fertility, abnormal cellular respiration, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,069,951 T1634S probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Col6a4 C T 9: 106,000,320 V2153M probably damaging Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Lrrc73 G A 17: 46,254,562 R73H probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mx1 A G 16: 97,448,296 I347T unknown Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Olfr385 A T 11: 73,589,735 M1K probably null Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Ptpn6 A G 6: 124,721,858 S498P possibly damaging Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Selenoo T A 15: 89,089,224 M39K probably benign Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in Immp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Immp2l APN 12 41068321 missense probably benign 0.26
IGL01696:Immp2l APN 12 41628807 missense probably damaging 1.00
IGL03082:Immp2l APN 12 41110901 missense possibly damaging 0.75
imp UTSW 12 41110847 nonsense probably null
R1583:Immp2l UTSW 12 41703765 splice site probably benign
R1636:Immp2l UTSW 12 41703687 missense probably damaging 1.00
R3404:Immp2l UTSW 12 41110847 nonsense probably null
R3405:Immp2l UTSW 12 41110847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGTCTGAAAACTCATTTGTTC -3'
(R):5'- CTACATGAAGCCTAACAGTTGC -3'

Sequencing Primer
(F):5'- AGCTATGAAGTACACTGCA -3'
(R):5'- TGAAGCCTAACAGTTGCTATATCTC -3'
Posted On2019-06-26