Incidental Mutation 'R7238:Serpina3k'
ID 563023
Institutional Source Beutler Lab
Gene Symbol Serpina3k
Ensembl Gene ENSMUSG00000058207
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3K
Synonyms Spi-2, alpha-1 antiproteinase, MMSpi2, 1300001I07Rik, RP54, contrapsin, Spi2, MMCM2, D12Rp54
MMRRC Submission 045345-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7238 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 104304745-104311998 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104309367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 270 (N270K)
Ref Sequence ENSEMBL: ENSMUSP00000042095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043058] [ENSMUST00000101078]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043058
AA Change: N270K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042095
Gene: ENSMUSG00000058207
AA Change: N270K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 57 417 4.77e-195 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101078
SMART Domains Protein: ENSMUSP00000098639
Gene: ENSMUSG00000079012

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,775,712 (GRCm39) T1634S probably damaging Het
Adgrl1 T A 8: 84,665,693 (GRCm39) M1460K probably damaging Het
Adig T A 2: 158,347,773 (GRCm39) L29Q unknown Het
Adnp T G 2: 168,025,887 (GRCm39) K469N probably damaging Het
Akap3 A G 6: 126,842,200 (GRCm39) D273G probably benign Het
Albfm1 A T 5: 90,727,519 (GRCm39) Y379F probably damaging Het
Ankrd34b T C 13: 92,575,139 (GRCm39) Y124H possibly damaging Het
Ap2b1 T G 11: 83,223,948 (GRCm39) F221C possibly damaging Het
Atp2c2 A G 8: 120,469,160 (GRCm39) I358V possibly damaging Het
BC051665 G A 13: 60,930,536 (GRCm39) T272I probably benign Het
Cdan1 G T 2: 120,560,783 (GRCm39) A262E probably benign Het
Ces1d C T 8: 93,904,763 (GRCm39) V326I probably benign Het
Chd3 T C 11: 69,254,873 (GRCm39) R156G probably benign Het
Clip1 C T 5: 123,751,328 (GRCm39) E818K Het
Col6a4 C T 9: 105,877,519 (GRCm39) V2153M probably damaging Het
Crlf3 T C 11: 79,947,351 (GRCm39) N296D possibly damaging Het
Cstdc6 C T 16: 36,142,193 (GRCm39) G61D probably benign Het
D130052B06Rik A G 11: 33,573,594 (GRCm39) I109V probably benign Het
Dcaf5 G T 12: 80,385,483 (GRCm39) T881K probably benign Het
Dennd4a C A 9: 64,769,238 (GRCm39) T408K probably damaging Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Dnah2 A G 11: 69,349,972 (GRCm39) probably null Het
Eif1ad8 A T 12: 87,564,006 (GRCm39) K114* probably null Het
Eif2ak2 C T 17: 79,173,760 (GRCm39) V273I probably benign Het
Elac1 C T 18: 73,872,359 (GRCm39) G212D probably damaging Het
Ercc6l2 A G 13: 64,013,798 (GRCm39) D623G probably damaging Het
Exo1 T C 1: 175,716,413 (GRCm39) F177L probably damaging Het
Fat4 A G 3: 38,944,562 (GRCm39) T1152A probably benign Het
Fbxl12 G T 9: 20,529,709 (GRCm39) probably null Het
Fbxo43 T C 15: 36,151,971 (GRCm39) Y582C probably damaging Het
Fsip2 T A 2: 82,812,484 (GRCm39) N2934K possibly damaging Het
Gna12 A G 5: 140,815,847 (GRCm39) S69P probably damaging Het
Gpatch8 C A 11: 102,369,354 (GRCm39) G1395C probably damaging Het
Gpr137c A G 14: 45,516,148 (GRCm39) Y294C probably damaging Het
Greb1 A G 12: 16,724,673 (GRCm39) S1834P probably damaging Het
Grin2b T C 6: 135,757,249 (GRCm39) D404G probably damaging Het
Hectd2 A T 19: 36,574,478 (GRCm39) N236I probably damaging Het
Hhip C T 8: 80,713,641 (GRCm39) V562I probably benign Het
Hipk2 G T 6: 38,692,992 (GRCm39) T867N probably benign Het
Hmgcl T C 4: 135,689,424 (GRCm39) V294A possibly damaging Het
Hnrnpl T A 7: 28,513,400 (GRCm39) F158I Het
Hspa5 T C 2: 34,662,383 (GRCm39) V17A unknown Het
Hspg2 T C 4: 137,235,704 (GRCm39) V168A probably damaging Het
Idh1 A G 1: 65,205,284 (GRCm39) F227S probably damaging Het
Iigp1c A G 18: 60,379,355 (GRCm39) S297G possibly damaging Het
Immp2l T C 12: 41,160,915 (GRCm39) V71A possibly damaging Het
Iqce G A 5: 140,675,713 (GRCm39) R193* probably null Het
Kcnq5 T C 1: 21,472,526 (GRCm39) D907G probably benign Het
Krt17 T A 11: 100,148,613 (GRCm39) T306S probably benign Het
Lhx3 T C 2: 26,093,009 (GRCm39) D149G probably damaging Het
Lrrc73 G A 17: 46,565,488 (GRCm39) R73H probably damaging Het
Mgat5b T C 11: 116,875,809 (GRCm39) S678P probably benign Het
Mink1 T C 11: 70,502,305 (GRCm39) probably null Het
Mroh5 T G 15: 73,663,278 (GRCm39) probably null Het
Muc5ac T A 7: 141,363,254 (GRCm39) H2188Q unknown Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Musk G A 4: 58,344,312 (GRCm39) G305D probably benign Het
Mx1 A G 16: 97,249,496 (GRCm39) I347T unknown Het
Mybbp1a G T 11: 72,334,338 (GRCm39) V198F probably damaging Het
Mycbp2 A G 14: 103,393,733 (GRCm39) S2943P probably damaging Het
Myo18a G A 11: 77,733,059 (GRCm39) R1363K probably damaging Het
Nav3 T A 10: 109,689,185 (GRCm39) D364V possibly damaging Het
Or13g1 T C 7: 85,955,799 (GRCm39) H174R probably damaging Het
Or14j6 T C 17: 38,215,328 (GRCm39) L297S probably benign Het
Or1e26 A T 11: 73,480,561 (GRCm39) M1K probably null Het
Or1j13 T A 2: 36,369,726 (GRCm39) N139Y possibly damaging Het
Or5k15 T A 16: 58,710,252 (GRCm39) E110D probably damaging Het
Pecr T C 1: 72,298,592 (GRCm39) D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Ppp1cb A T 5: 32,648,376 (GRCm39) T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 (GRCm39) K1084N probably damaging Het
Prdm2 A G 4: 142,862,391 (GRCm39) S300P probably benign Het
Prkg1 C T 19: 30,602,090 (GRCm39) V389I probably damaging Het
Psg25 C T 7: 18,266,127 (GRCm39) probably benign Het
Ptpn6 A G 6: 124,698,821 (GRCm39) S498P possibly damaging Het
Pus3 A G 9: 35,477,965 (GRCm39) H399R probably benign Het
Pus7 T C 5: 23,983,450 (GRCm39) T6A probably benign Het
Rnf169 A G 7: 99,574,954 (GRCm39) V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,128 (GRCm39) probably benign Het
Ryr1 C T 7: 28,794,807 (GRCm39) D1194N probably benign Het
Scn5a T C 9: 119,320,610 (GRCm39) M1490V possibly damaging Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Selenoo T A 15: 88,973,427 (GRCm39) M39K probably benign Het
Septin8 T G 11: 53,427,519 (GRCm39) V246G possibly damaging Het
Setd5 G A 6: 113,098,091 (GRCm39) R710H probably damaging Het
Sirt4 A T 5: 115,621,049 (GRCm39) I41N possibly damaging Het
Slc26a9 T A 1: 131,686,556 (GRCm39) Y425* probably null Het
Slc4a9 A G 18: 36,662,773 (GRCm39) E176G probably benign Het
Speer1m T C 5: 11,970,712 (GRCm39) I127T Het
Spidr A T 16: 15,784,680 (GRCm39) W463R probably benign Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Tmcc1 G A 6: 116,111,198 (GRCm39) Q28* probably null Het
Tmem52b A G 6: 129,493,651 (GRCm39) E88G probably damaging Het
Trpc7 A T 13: 56,974,710 (GRCm39) I402K probably benign Het
Tshz3 T C 7: 36,469,522 (GRCm39) Y504H probably damaging Het
Ttn T C 2: 76,542,549 (GRCm39) E33479G possibly damaging Het
Ttn G A 2: 76,711,672 (GRCm39) R8290C unknown Het
Urb1 T C 16: 90,549,003 (GRCm39) D2235G possibly damaging Het
Usp10 T C 8: 120,668,283 (GRCm39) F195L probably benign Het
Vmn1r31 A T 6: 58,449,858 (GRCm39) F2L Het
Vmn2r109 C T 17: 20,761,336 (GRCm39) V674M probably damaging Het
Vmn2r12 G A 5: 109,245,655 (GRCm39) P26S possibly damaging Het
Vmn2r61 T A 7: 41,916,629 (GRCm39) M414K possibly damaging Het
Yipf3 T C 17: 46,562,585 (GRCm39) V330A probably benign Het
Zic4 A T 9: 91,261,450 (GRCm39) H235L probably benign Het
Zxdc T A 6: 90,346,642 (GRCm39) W16R unknown Het
Other mutations in Serpina3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Serpina3k APN 12 104,309,369 (GRCm39) missense probably benign 0.36
IGL01402:Serpina3k APN 12 104,306,882 (GRCm39) missense probably benign 0.00
IGL01404:Serpina3k APN 12 104,306,882 (GRCm39) missense probably benign 0.00
IGL01958:Serpina3k APN 12 104,307,316 (GRCm39) missense probably damaging 1.00
IGL02031:Serpina3k APN 12 104,311,525 (GRCm39) missense probably benign 0.08
IGL02055:Serpina3k APN 12 104,307,295 (GRCm39) nonsense probably null
IGL02981:Serpina3k APN 12 104,307,250 (GRCm39) missense probably benign 0.02
IGL03269:Serpina3k APN 12 104,306,780 (GRCm39) missense possibly damaging 0.83
R1076:Serpina3k UTSW 12 104,307,253 (GRCm39) missense probably benign 0.00
R2360:Serpina3k UTSW 12 104,307,166 (GRCm39) nonsense probably null
R3816:Serpina3k UTSW 12 104,307,221 (GRCm39) missense probably benign 0.08
R4577:Serpina3k UTSW 12 104,310,451 (GRCm39) missense possibly damaging 0.94
R4656:Serpina3k UTSW 12 104,311,532 (GRCm39) missense probably damaging 1.00
R4732:Serpina3k UTSW 12 104,307,119 (GRCm39) missense probably damaging 1.00
R4733:Serpina3k UTSW 12 104,307,119 (GRCm39) missense probably damaging 1.00
R4916:Serpina3k UTSW 12 104,309,269 (GRCm39) missense probably damaging 1.00
R4999:Serpina3k UTSW 12 104,307,305 (GRCm39) missense probably damaging 1.00
R5053:Serpina3k UTSW 12 104,309,473 (GRCm39) critical splice donor site probably null
R6300:Serpina3k UTSW 12 104,306,981 (GRCm39) missense probably damaging 1.00
R6343:Serpina3k UTSW 12 104,311,562 (GRCm39) missense probably benign
R6851:Serpina3k UTSW 12 104,311,625 (GRCm39) missense probably benign 0.00
R6858:Serpina3k UTSW 12 104,311,504 (GRCm39) missense possibly damaging 0.85
R6872:Serpina3k UTSW 12 104,310,519 (GRCm39) missense probably benign 0.25
R6992:Serpina3k UTSW 12 104,307,366 (GRCm39) missense probably benign 0.00
R7025:Serpina3k UTSW 12 104,307,401 (GRCm39) missense probably benign 0.01
R7050:Serpina3k UTSW 12 104,307,403 (GRCm39) missense possibly damaging 0.96
R7240:Serpina3k UTSW 12 104,306,861 (GRCm39) missense probably benign 0.05
R7469:Serpina3k UTSW 12 104,311,594 (GRCm39) missense not run
R8837:Serpina3k UTSW 12 104,309,292 (GRCm39) missense probably benign 0.00
R9025:Serpina3k UTSW 12 104,307,230 (GRCm39) missense probably damaging 1.00
R9497:Serpina3k UTSW 12 104,309,430 (GRCm39) missense probably benign 0.01
X0019:Serpina3k UTSW 12 104,306,834 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTCATCTTTAGGCAAATGGAAG -3'
(R):5'- GGAATGCCCACCATTACAAAGG -3'

Sequencing Primer
(F):5'- GGAAGATATCCTTTGACCCCCAGG -3'
(R):5'- TACTAGTGAGACTCTGAGGTACAG -3'
Posted On 2019-06-26