Incidental Mutation 'R7238:Selenoo'
ID563031
Institutional Source Beutler Lab
Gene Symbol Selenoo
Ensembl Gene ENSMUSG00000035757
Gene Nameselenoprotein O
SynonymsSelo, 1300018J18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7238 (G1)
Quality Score158.009
Status Not validated
Chromosome15
Chromosomal Location89089084-89100340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89089224 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 39 (M39K)
Ref Sequence ENSEMBL: ENSMUSP00000081020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081702] [ENSMUST00000082439] [ENSMUST00000130700] [ENSMUST00000165690] [ENSMUST00000168863] [ENSMUST00000169870] [ENSMUST00000169891]
Predicted Effect probably benign
Transcript: ENSMUST00000081702
SMART Domains Protein: ENSMUSP00000080403
Gene: ENSMUSG00000015363

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 367 8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082439
AA Change: M39K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757
AA Change: M39K

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130700
AA Change: M39K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757
AA Change: M39K

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 80 241 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165690
SMART Domains Protein: ENSMUSP00000131228
Gene: ENSMUSG00000015363

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 310 9.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168863
SMART Domains Protein: ENSMUSP00000130292
Gene: ENSMUSG00000015363

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 235 1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169870
Predicted Effect probably benign
Transcript: ENSMUST00000169891
SMART Domains Protein: ENSMUSP00000128721
Gene: ENSMUSG00000015363

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 276 8.8e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: This gene encodes a selenoprotein that is localized to the mitochondria. It is the largest mammalian selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The exact function of this selenoprotein is not known, but it is thought to have redox activity. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,069,951 T1634S probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Col6a4 C T 9: 106,000,320 V2153M probably damaging Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Immp2l T C 12: 41,110,916 V71A possibly damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Lrrc73 G A 17: 46,254,562 R73H probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mx1 A G 16: 97,448,296 I347T unknown Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Olfr385 A T 11: 73,589,735 M1K probably null Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Ptpn6 A G 6: 124,721,858 S498P possibly damaging Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in Selenoo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Selenoo APN 15 89095672 missense probably damaging 1.00
IGL01922:Selenoo APN 15 89099649 missense probably benign 0.06
IGL02103:Selenoo APN 15 89099970 missense probably damaging 1.00
R0655:Selenoo UTSW 15 89095655 missense probably damaging 1.00
R0960:Selenoo UTSW 15 89096754 missense probably benign 0.08
R1610:Selenoo UTSW 15 89099916 missense probably benign
R2152:Selenoo UTSW 15 89099282 missense probably benign 0.01
R4177:Selenoo UTSW 15 89099459 unclassified probably benign
R4588:Selenoo UTSW 15 89096718 missense probably benign 0.01
R4622:Selenoo UTSW 15 89095707 nonsense probably null
R4731:Selenoo UTSW 15 89099328 missense probably benign 0.00
R4926:Selenoo UTSW 15 89099678 missense probably damaging 0.98
R4934:Selenoo UTSW 15 89098767 missense probably damaging 0.98
R4999:Selenoo UTSW 15 89094184 missense probably damaging 1.00
R5000:Selenoo UTSW 15 89094184 missense probably damaging 1.00
R5033:Selenoo UTSW 15 89092766 missense probably damaging 1.00
R5120:Selenoo UTSW 15 89094305 missense possibly damaging 0.79
R6034:Selenoo UTSW 15 89099343 missense probably benign 0.00
R6034:Selenoo UTSW 15 89099343 missense probably benign 0.00
R7287:Selenoo UTSW 15 89098700 missense probably benign 0.01
R7378:Selenoo UTSW 15 89089478 missense probably benign 0.07
R7818:Selenoo UTSW 15 89096816 missense probably damaging 1.00
R8058:Selenoo UTSW 15 89092739 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATCAGAACCAAGCTTCTGGGC -3'
(R):5'- CATTGCCGCTGAAGAAGAGC -3'

Sequencing Primer
(F):5'- AAGCTTCTGGGCGTGCCTC -3'
(R):5'- TCTGACAGCGCCACCAG -3'
Posted On2019-06-26