Incidental Mutation 'R7238:Mx1'
ID563036
Institutional Source Beutler Lab
Gene Symbol Mx1
Ensembl Gene ENSMUSG00000000386
Gene NameMX dynamin-like GTPase 1
SynonymsMx-1, Mx, myxovirus (influenza) resistance 1 polypeptide
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7238 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location97447035-97462907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97448296 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 347 (I347T)
Ref Sequence ENSEMBL: ENSMUSP00000109397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023655] [ENSMUST00000113768] [ENSMUST00000135184] [ENSMUST00000155233] [ENSMUST00000232193] [ENSMUST00000232282]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023655
AA Change: I577T

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023655
Gene: ENSMUSG00000000386
AA Change: I577T

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
low complexity region 309 325 N/A INTRINSIC
Pfam:Dynamin_M 428 509 8.1e-12 PFAM
GED 534 625 5.58e-38 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113768
AA Change: I347T
SMART Domains Protein: ENSMUSP00000109397
Gene: ENSMUSG00000000386
AA Change: I347T

DomainStartEndE-ValueType
DYNc 12 241 1.34e-98 SMART
low complexity region 279 289 N/A INTRINSIC
GED 304 395 5.58e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135184
SMART Domains Protein: ENSMUSP00000138813
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 2 111 2.62e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155233
SMART Domains Protein: ENSMUSP00000138532
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
Predicted Effect unknown
Transcript: ENSMUST00000232193
AA Change: I249T
Predicted Effect probably benign
Transcript: ENSMUST00000232282
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
MGI Phenotype FUNCTION: This gene encodes a member of the Mx protein family of large GTPases, and functions in the innate immunity system. Interferon alpha/beta treatment or viral infection induces expression of this protein, which subsequently accumulates in the cytoplasm and inhibits viral replication. It has been shown to confer resistance to the influenza virus. This gene produces a functional protein in some feral mouse strains, whereas some inbred mouse strains including the strain of the reference genome, C57BL/6J, contain a deletion or a nonsense mutation that results in a non-functional gene product. [provided by RefSeq, Aug 2015]
PHENOTYPE: A2G, SL/NiA, T9 and CAST/Ei strains produce the MX1 protein (Mx1+ allele) conferring resistance to myxoviruses, whereas no protein is made by the Mx1- susceptible alleles of C57BL/6J and many other inbred strains with an exon 9-11 deletion; or CBA/J, CE/J, I/LnJ and PERA/Ei with a nonsense mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,069,951 T1634S probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Col6a4 C T 9: 106,000,320 V2153M probably damaging Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Immp2l T C 12: 41,110,916 V71A possibly damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Lrrc73 G A 17: 46,254,562 R73H probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Olfr385 A T 11: 73,589,735 M1K probably null Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Ptpn6 A G 6: 124,721,858 S498P possibly damaging Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Selenoo T A 15: 89,089,224 M39K probably benign Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in Mx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Mx1 APN 16 97457432 missense probably damaging 1.00
IGL01328:Mx1 APN 16 97455632 missense probably damaging 0.99
IGL03105:Mx1 APN 16 97456354 missense possibly damaging 0.94
PIT4585001:Mx1 UTSW 16 97456254 missense probably benign 0.07
R0003:Mx1 UTSW 16 97451588 intron probably benign
R1597:Mx1 UTSW 16 97455129 missense probably damaging 1.00
R1753:Mx1 UTSW 16 97454158 missense probably damaging 1.00
R1780:Mx1 UTSW 16 97451512 makesense probably null
R1826:Mx1 UTSW 16 97455637 missense possibly damaging 0.95
R1851:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R1852:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R2059:Mx1 UTSW 16 97454179 nonsense probably null
R2223:Mx1 UTSW 16 97455232 splice site probably benign
R3441:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3442:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3782:Mx1 UTSW 16 97451995 missense possibly damaging 0.75
R4460:Mx1 UTSW 16 97454081 missense probably damaging 0.99
R4659:Mx1 UTSW 16 97455239 splice site probably null
R5116:Mx1 UTSW 16 97457479 missense possibly damaging 0.67
R5186:Mx1 UTSW 16 97455494 missense probably benign 0.09
R5215:Mx1 UTSW 16 97448360 missense possibly damaging 0.72
R5249:Mx1 UTSW 16 97457428 missense probably damaging 1.00
R5450:Mx1 UTSW 16 97454147 nonsense probably null
R5806:Mx1 UTSW 16 97454151 missense possibly damaging 0.81
R5894:Mx1 UTSW 16 97454206 missense probably damaging 1.00
R5916:Mx1 UTSW 16 97451733 missense probably benign 0.00
R5981:Mx1 UTSW 16 97454205 missense probably damaging 1.00
R7111:Mx1 UTSW 16 97455176 missense probably damaging 0.99
R7207:Mx1 UTSW 16 97452198 missense probably benign
R7318:Mx1 UTSW 16 97452086 missense probably benign 0.06
R7699:Mx1 UTSW 16 97448321 missense unknown
R7856:Mx1 UTSW 16 97455535 missense probably damaging 1.00
R8012:Mx1 UTSW 16 97457372 missense probably damaging 1.00
R8444:Mx1 UTSW 16 97451487 nonsense probably null
X0028:Mx1 UTSW 16 97450421 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGATCATTGCACAGCGACC -3'
(R):5'- TGAGACTGGGCTAGAATCATGC -3'

Sequencing Primer
(F):5'- CATTGCACAGCGACCAGGAAAG -3'
(R):5'- ACTGGGCTAGAATCATGCATCTG -3'
Posted On2019-06-26