Incidental Mutation 'R7238:Lrrc73'
ID563040
Institutional Source Beutler Lab
Gene Symbol Lrrc73
Ensembl Gene ENSMUSG00000071073
Gene Nameleucine rich repeat containing 73
SynonymsGm88, LOC224813
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R7238 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46254165-46257316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46254562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 73 (R73H)
Ref Sequence ENSEMBL: ENSMUSP00000092896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012440] [ENSMUST00000095262] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000164342] [ENSMUST00000180283] [ENSMUST00000225080] [ENSMUST00000225413]
Predicted Effect probably benign
Transcript: ENSMUST00000012440
SMART Domains Protein: ENSMUSP00000012440
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095262
AA Change: R73H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092896
Gene: ENSMUSG00000071073
AA Change: R73H

DomainStartEndE-ValueType
LRR 27 54 2.42e1 SMART
LRR 84 111 3.47e1 SMART
LRR 112 139 1.84e0 SMART
LRR 143 171 1.66e2 SMART
LRR 172 199 5.41e0 SMART
LRR 200 227 3.54e0 SMART
LRR 229 256 5.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095263
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123311
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164342
SMART Domains Protein: ENSMUSP00000130710
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 262 447 1.5e-59 PFAM
Pfam:Pilt 442 538 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180283
SMART Domains Protein: ENSMUSP00000137220
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225080
Predicted Effect probably benign
Transcript: ENSMUST00000225413
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,069,951 T1634S probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Col6a4 C T 9: 106,000,320 V2153M probably damaging Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Immp2l T C 12: 41,110,916 V71A possibly damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mx1 A G 16: 97,448,296 I347T unknown Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Olfr385 A T 11: 73,589,735 M1K probably null Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Ptpn6 A G 6: 124,721,858 S498P possibly damaging Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Selenoo T A 15: 89,089,224 M39K probably benign Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in Lrrc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Lrrc73 APN 17 46255731 missense possibly damaging 0.95
IGL02499:Lrrc73 APN 17 46256989 unclassified probably benign
R1643:Lrrc73 UTSW 17 46255340 critical splice donor site probably null
R1748:Lrrc73 UTSW 17 46255695 missense probably damaging 1.00
R7164:Lrrc73 UTSW 17 46256243 missense probably damaging 1.00
R7432:Lrrc73 UTSW 17 46255783 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTAGCTCCATCCAGATTTCG -3'
(R):5'- ATGTGCATTAGAGGTTGCGAAG -3'

Sequencing Primer
(F):5'- TCCATCCAGATTTCGGGGGAG -3'
(R):5'- TGCATTAGAGGTTGCGAAGGTAGG -3'
Posted On2019-06-26