Incidental Mutation 'R7239:Gnas'
ID563053
Institutional Source Beutler Lab
Gene Symbol Gnas
Ensembl Gene ENSMUSG00000027523
Gene NameGNAS (guanine nucleotide binding protein, alpha stimulating) complex locus
SynonymsGnasxl, C130027O20Rik, 5530400H20Rik, Nespl, Nesp, A930027G11Rik, Gs alpha, G alpha s, Gsa, Nesp55, Galphas, Gnas1, P1, Gs-alpha, XLalphas, P3, neuroendocrine-specific Golgi protein p55 isoform 1, Oedsml, P2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7239 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location174284320-174346744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 174298615 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 252 (G252R)
Ref Sequence ENSEMBL: ENSMUSP00000079341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080493] [ENSMUST00000087876] [ENSMUST00000087877] [ENSMUST00000109088] [ENSMUST00000109095] [ENSMUST00000109096] [ENSMUST00000130761] [ENSMUST00000130940] [ENSMUST00000180362] [ENSMUST00000185956] [ENSMUST00000186907]
Predicted Effect unknown
Transcript: ENSMUST00000080493
AA Change: G252R
SMART Domains Protein: ENSMUSP00000079341
Gene: ENSMUSG00000027523
AA Change: G252R

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087876
AA Change: G252R
SMART Domains Protein: ENSMUSP00000085184
Gene: ENSMUSG00000027523
AA Change: G252R

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 2.42e-8 PROSPERO
internal_repeat_1 209 276 2.42e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1118 8.32e-191 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087877
AA Change: G252R
SMART Domains Protein: ENSMUSP00000085185
Gene: ENSMUSG00000027523
AA Change: G252R

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 1.1e-8 PROSPERO
internal_repeat_1 209 276 1.1e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
Blast:G_alpha 759 799 2e-14 BLAST
low complexity region 802 816 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000109088
SMART Domains Protein: ENSMUSP00000104716
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109095
SMART Domains Protein: ENSMUSP00000104723
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109096
SMART Domains Protein: ENSMUSP00000104724
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130761
Predicted Effect probably benign
Transcript: ENSMUST00000130940
SMART Domains Protein: ENSMUSP00000118210
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 59 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180362
SMART Domains Protein: ENSMUSP00000136180
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000185956
AA Change: G252R
SMART Domains Protein: ENSMUSP00000140174
Gene: ENSMUSG00000027523
AA Change: G252R

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect silent
Transcript: ENSMUST00000186907
SMART Domains Protein: ENSMUSP00000139839
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mutant homozygotes stop developing normally by embryonic day 10.5 and die prenatally. On some backgrounds heterozygotes show imprinted phenotypes, including differences in body shape/weight, locomotor activity, metabolism, and developmental anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Psd2 G A 18: 35,980,419 A315T probably damaging Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Gnas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gnas APN 2 174341711 splice site probably benign
IGL00928:Gnas APN 2 174297953 nonsense probably null
IGL01014:Gnas APN 2 174297974 utr 5 prime probably benign
IGL01743:Gnas APN 2 174298332 nonsense probably null
IGL01808:Gnas APN 2 174298697 missense probably damaging 0.96
IGL02559:Gnas APN 2 174341936 splice site probably benign
R0555:Gnas UTSW 2 174298511 missense possibly damaging 0.78
R0627:Gnas UTSW 2 174298135 intron probably benign
R1418:Gnas UTSW 2 174345214 splice site probably benign
R1706:Gnas UTSW 2 174299975 missense possibly damaging 0.90
R1751:Gnas UTSW 2 174297894 utr 5 prime probably benign
R1968:Gnas UTSW 2 174298733 missense probably damaging 0.96
R2290:Gnas UTSW 2 174300010 missense probably benign 0.09
R4125:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4128:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4697:Gnas UTSW 2 174298080 missense probably damaging 1.00
R4888:Gnas UTSW 2 174298089 missense possibly damaging 0.94
R5458:Gnas UTSW 2 174298331 missense probably benign 0.41
R5640:Gnas UTSW 2 174284971 missense probably benign 0.44
R5696:Gnas UTSW 2 174299675 intron probably benign
R5757:Gnas UTSW 2 174345247 missense probably damaging 1.00
R6053:Gnas UTSW 2 174299852 missense possibly damaging 0.89
R6083:Gnas UTSW 2 174297862 start codon destroyed probably null
R6736:Gnas UTSW 2 174334251 missense probably damaging 0.98
R7074:Gnas UTSW 2 174285049 missense probably damaging 1.00
R7541:Gnas UTSW 2 174298099 missense unknown
X0022:Gnas UTSW 2 174299744 missense probably benign 0.33
Z1088:Gnas UTSW 2 174298373 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATTTGAGTTCAACGAGCCTGC -3'
(R):5'- CAATCTCAAGCAGGGGTCTG -3'

Sequencing Primer
(F):5'- TGCAAGTCCCAGACCTTGC -3'
(R):5'- CAGGGGTCTGGTGATCTCCATC -3'
Posted On2019-06-26