Incidental Mutation 'R0578:Ccdc61'
ID56308
Institutional Source Beutler Lab
Gene Symbol Ccdc61
Ensembl Gene ENSMUSG00000074358
Gene Namecoiled-coil domain containing 61
SynonymsC530028I08Rik, LOC232933
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R0578 (G1)
Quality Score196
Status Validated
Chromosome7
Chromosomal Location18890883-18910415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18903475 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000096377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098780] [ENSMUST00000135467] [ENSMUST00000139077] [ENSMUST00000150065]
Predicted Effect probably benign
Transcript: ENSMUST00000098780
AA Change: T76A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096377
Gene: ENSMUSG00000074358
AA Change: T76A

DomainStartEndE-ValueType
coiled coil region 173 206 N/A INTRINSIC
low complexity region 217 242 N/A INTRINSIC
coiled coil region 243 280 N/A INTRINSIC
low complexity region 290 332 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 400 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135467
AA Change: T76A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000139077
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000150065
AA Change: T76A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Ccdc61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ccdc61 APN 7 18892558 missense probably benign
IGL02029:Ccdc61 APN 7 18903498 missense probably damaging 1.00
IGL02550:Ccdc61 APN 7 18893302 missense probably benign 0.03
I0000:Ccdc61 UTSW 7 18903549 missense probably damaging 1.00
R0055:Ccdc61 UTSW 7 18892536 missense probably damaging 1.00
R0055:Ccdc61 UTSW 7 18892536 missense probably damaging 1.00
R0392:Ccdc61 UTSW 7 18891102 missense probably benign 0.27
R1740:Ccdc61 UTSW 7 18903937 splice site probably benign
R2230:Ccdc61 UTSW 7 18891107 missense probably damaging 0.98
R5964:Ccdc61 UTSW 7 18900940 missense probably damaging 1.00
R6345:Ccdc61 UTSW 7 18909989 intron probably null
R6893:Ccdc61 UTSW 7 18892563 missense possibly damaging 0.94
R7466:Ccdc61 UTSW 7 18891105 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACATTTCCCTGGGACCTGAATCTAT -3'
(R):5'- TGGGCAGAGCTGGAGAACTTACT -3'

Sequencing Primer
(F):5'- gtgtgtgagagagagagagagag -3'
(R):5'- GGAGAACTTACTCCAGCATATTGC -3'
Posted On2013-07-11