Incidental Mutation 'R7239:Psd2'
ID563113
Institutional Source Beutler Lab
Gene Symbol Psd2
Ensembl Gene ENSMUSG00000024347
Gene Namepleckstrin and Sec7 domain containing 2
SynonymsEFA6C, 6330404E20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028707

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7239 (G1)
Quality Score193.009
Status Validated
Chromosome18
Chromosomal Location35964830-36014715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35980419 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 315 (A315T)
Ref Sequence ENSEMBL: ENSMUSP00000135795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115716] [ENSMUST00000175734] [ENSMUST00000176472] [ENSMUST00000176873] [ENSMUST00000177432]
Predicted Effect probably damaging
Transcript: ENSMUST00000115716
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111381
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 624 4.35e-14 SMART
Blast:Sec7 653 705 4e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000175734
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135795
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.1e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176472
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135285
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
Pfam:PH_9 511 553 4.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176873
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135616
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.2e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177432
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135431
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 621 5.36e-14 SMART
Blast:Sec7 650 702 4e-24 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Psd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Psd2 APN 18 35980335 missense probably benign 0.00
IGL01578:Psd2 APN 18 35979785 missense probably damaging 1.00
IGL02086:Psd2 APN 18 36005906 missense probably damaging 1.00
IGL02132:Psd2 APN 18 36004756 splice site probably benign
IGL02480:Psd2 APN 18 36006083 missense probably damaging 1.00
IGL02726:Psd2 APN 18 35987302 critical splice donor site probably null
3-1:Psd2 UTSW 18 35984401 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0320:Psd2 UTSW 18 35979644 missense probably damaging 1.00
R0573:Psd2 UTSW 18 35980493 splice site probably benign
R0685:Psd2 UTSW 18 36002991 missense possibly damaging 0.90
R0698:Psd2 UTSW 18 36012711 missense probably benign 0.22
R0730:Psd2 UTSW 18 35978574 missense possibly damaging 0.85
R0971:Psd2 UTSW 18 35979786 missense probably damaging 1.00
R1085:Psd2 UTSW 18 36012777 missense probably benign 0.10
R1535:Psd2 UTSW 18 36005790 missense probably benign 0.31
R2056:Psd2 UTSW 18 36006691 missense possibly damaging 0.60
R4011:Psd2 UTSW 18 35987247 missense probably benign 0.01
R4246:Psd2 UTSW 18 36006119 missense probably damaging 1.00
R4335:Psd2 UTSW 18 36007530 missense probably damaging 0.96
R4584:Psd2 UTSW 18 36012828 missense probably benign
R4942:Psd2 UTSW 18 35978664 missense probably damaging 1.00
R5120:Psd2 UTSW 18 35979810 missense possibly damaging 0.92
R5373:Psd2 UTSW 18 36007503 missense probably damaging 1.00
R5374:Psd2 UTSW 18 36007503 missense probably damaging 1.00
R5839:Psd2 UTSW 18 36007524 missense probably damaging 0.97
R6200:Psd2 UTSW 18 36006723 splice site probably null
R6925:Psd2 UTSW 18 35979711 missense probably damaging 1.00
R6967:Psd2 UTSW 18 35980332 missense probably damaging 0.97
R7074:Psd2 UTSW 18 36010684 missense probably benign 0.03
R7142:Psd2 UTSW 18 35980044 missense possibly damaging 0.85
R7348:Psd2 UTSW 18 35980336 missense possibly damaging 0.85
R7581:Psd2 UTSW 18 35979997 missense probably benign 0.01
X0065:Psd2 UTSW 18 36002942 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCCCACAGTGGATTTTCAGAG -3'
(R):5'- CCTTGAAAGCCTAGTGGGAG -3'

Sequencing Primer
(F):5'- CCACAGTGGATTTTCAGAGACCTG -3'
(R):5'- AAAGCCTAGTGGGAGCTCCTG -3'
Posted On2019-06-26