Incidental Mutation 'R7239:Psd2'
ID563113
Institutional Source Beutler Lab
Gene Symbol Psd2
Ensembl Gene ENSMUSG00000024347
Gene Namepleckstrin and Sec7 domain containing 2
SynonymsEFA6C, 6330404E20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028707

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7239 (G1)
Quality Score193.009
Status Validated
Chromosome18
Chromosomal Location35964830-36014715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35980419 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 315 (A315T)
Ref Sequence ENSEMBL: ENSMUSP00000135795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115716] [ENSMUST00000175734] [ENSMUST00000176472] [ENSMUST00000176873] [ENSMUST00000177432]
Predicted Effect probably damaging
Transcript: ENSMUST00000115716
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111381
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 624 4.35e-14 SMART
Blast:Sec7 653 705 4e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000175734
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135795
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.1e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176472
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135285
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
Pfam:PH_9 511 553 4.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176873
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135616
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.2e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177432
AA Change: A315T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135431
Gene: ENSMUSG00000024347
AA Change: A315T

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 621 5.36e-14 SMART
Blast:Sec7 650 702 4e-24 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (76/77)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,518 V144A probably damaging Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca5 A T 11: 110,326,704 Y109N possibly damaging Het
Abcb5 T C 12: 118,928,725 Q433R probably benign Het
Adamts7 G A 9: 90,186,557 probably null Het
Adgrv1 T C 13: 81,476,612 D3746G possibly damaging Het
Arhgap29 C T 3: 121,988,950 S159L probably benign Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Atp1a3 G A 7: 25,000,704 P77L probably damaging Het
B4galt1 T C 4: 40,812,754 D257G probably damaging Het
Bin1 T A 18: 32,406,171 N52K probably damaging Het
Catsperg2 A G 7: 29,710,082 M562T probably benign Het
Ccdc33 G A 9: 58,032,909 Q713* probably null Het
Cd96 A T 16: 46,109,114 L156Q probably damaging Het
Clpb A G 7: 101,711,455 T231A probably damaging Het
Dnmt3a A T 12: 3,872,850 Q151L probably benign Het
Dock2 C T 11: 34,231,677 V1629M probably benign Het
Edem1 G A 6: 108,854,380 D601N probably benign Het
Eno2 C T 6: 124,768,265 V20M probably damaging Het
Eny2 A C 15: 44,433,854 D52A probably benign Het
Esp36 T C 17: 38,417,241 R93G possibly damaging Het
Fam227a A G 15: 79,634,062 probably null Het
Fat4 C A 3: 38,983,840 H3880Q possibly damaging Het
Fbxw24 A T 9: 109,605,530 V334E possibly damaging Het
Flrt1 T C 19: 7,095,964 Q406R probably benign Het
Frmpd2 A G 14: 33,552,077 N1092S probably benign Het
Gm904 C A 13: 50,645,251 T82K probably benign Het
Gnas G C 2: 174,298,615 G252R unknown Het
Gpatch2l A G 12: 86,260,575 probably null Het
Hist1h2ac A T 13: 23,683,610 I103N probably damaging Het
Ift74 T C 4: 94,652,950 V204A probably benign Het
Ikzf4 A G 10: 128,641,244 L119P probably damaging Het
Ing3 G A 6: 21,952,194 E56K probably damaging Het
Klhl25 T C 7: 75,866,768 I474T probably benign Het
Klhl5 T C 5: 65,161,186 V556A probably damaging Het
Krt14 A T 11: 100,204,255 M382K probably benign Het
Lmcd1 T C 6: 112,315,784 V199A possibly damaging Het
Lpcat4 T A 2: 112,242,707 F200I possibly damaging Het
Lrp1b T C 2: 41,004,713 T2282A Het
Lrrk1 T C 7: 66,262,155 T1886A probably benign Het
Meis2 T C 2: 116,059,003 probably null Het
Mki67 C T 7: 135,700,176 R1043K possibly damaging Het
Myct1 G T 10: 5,604,601 R156L possibly damaging Het
Nckap5l G T 15: 99,426,209 H804Q probably damaging Het
Ndst3 T G 3: 123,606,906 E450D probably damaging Het
Nipbl A T 15: 8,292,135 probably null Het
Npy A G 6: 49,823,607 N4D probably benign Het
Olfr855 A T 9: 19,585,191 Y218F probably damaging Het
Osgin2 T C 4: 16,008,748 S18G probably benign Het
Pcdha9 T G 18: 36,998,498 F207V probably benign Het
Pcdhb13 A T 18: 37,444,644 I692F probably damaging Het
Pde3b T A 7: 114,416,149 V200E probably damaging Het
Ppp6r3 A T 19: 3,493,981 L345I probably benign Het
Rnf111 G A 9: 70,469,373 T328I probably damaging Het
Rnf213 T C 11: 119,458,788 L3825P Het
Rtl1 C T 12: 109,592,475 V977I probably benign Het
Scn1a G A 2: 66,277,656 probably null Het
Slc25a2 G T 18: 37,637,695 N260K probably benign Het
Sprtn T C 8: 124,900,244 V121A probably damaging Het
Ssx2ip T G 3: 146,428,016 L260W probably damaging Het
Syde1 G A 10: 78,588,781 R406C probably damaging Het
Tab1 A G 15: 80,133,171 R6G probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tenm4 G A 7: 96,735,813 V526I possibly damaging Het
Tfap2b T C 1: 19,234,180 F405L probably damaging Het
Trbv13-1 C A 6: 41,116,391 T87K probably benign Het
Trmt44 G T 5: 35,574,786 A87E probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T C 2: 76,787,290 D16279G probably damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Ugt2b37 T A 5: 87,254,731 I14L probably benign Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r184 C T 7: 26,267,177 P116L possibly damaging Het
Zfp426 T C 9: 20,470,591 T367A probably benign Het
Zfp647 A T 15: 76,911,756 C235S probably damaging Het
Other mutations in Psd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Psd2 APN 18 35980335 missense probably benign 0.00
IGL01578:Psd2 APN 18 35979785 missense probably damaging 1.00
IGL02086:Psd2 APN 18 36005906 missense probably damaging 1.00
IGL02132:Psd2 APN 18 36004756 splice site probably benign
IGL02480:Psd2 APN 18 36006083 missense probably damaging 1.00
IGL02726:Psd2 APN 18 35987302 critical splice donor site probably null
Arachnida UTSW 18 36006723 splice site probably null
recluse UTSW 18 35979711 missense probably damaging 1.00
widow UTSW 18 35980425 missense probably damaging 0.99
3-1:Psd2 UTSW 18 35984401 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0320:Psd2 UTSW 18 35979644 missense probably damaging 1.00
R0573:Psd2 UTSW 18 35980493 splice site probably benign
R0685:Psd2 UTSW 18 36002991 missense possibly damaging 0.90
R0698:Psd2 UTSW 18 36012711 missense probably benign 0.22
R0730:Psd2 UTSW 18 35978574 missense possibly damaging 0.85
R0971:Psd2 UTSW 18 35979786 missense probably damaging 1.00
R1085:Psd2 UTSW 18 36012777 missense probably benign 0.10
R1535:Psd2 UTSW 18 36005790 missense probably benign 0.31
R2056:Psd2 UTSW 18 36006691 missense possibly damaging 0.60
R4011:Psd2 UTSW 18 35987247 missense probably benign 0.01
R4246:Psd2 UTSW 18 36006119 missense probably damaging 1.00
R4335:Psd2 UTSW 18 36007530 missense probably damaging 0.96
R4584:Psd2 UTSW 18 36012828 missense probably benign
R4942:Psd2 UTSW 18 35978664 missense probably damaging 1.00
R5120:Psd2 UTSW 18 35979810 missense possibly damaging 0.92
R5373:Psd2 UTSW 18 36007503 missense probably damaging 1.00
R5374:Psd2 UTSW 18 36007503 missense probably damaging 1.00
R5839:Psd2 UTSW 18 36007524 missense probably damaging 0.97
R6200:Psd2 UTSW 18 36006723 splice site probably null
R6925:Psd2 UTSW 18 35979711 missense probably damaging 1.00
R6967:Psd2 UTSW 18 35980332 missense probably damaging 0.97
R7074:Psd2 UTSW 18 36010684 missense probably benign 0.03
R7142:Psd2 UTSW 18 35980044 missense possibly damaging 0.85
R7348:Psd2 UTSW 18 35980336 missense possibly damaging 0.85
R7581:Psd2 UTSW 18 35979997 missense probably benign 0.01
R7793:Psd2 UTSW 18 36002979 missense probably benign 0.37
R8221:Psd2 UTSW 18 35980425 missense probably damaging 0.99
R8310:Psd2 UTSW 18 35979713 missense probably damaging 1.00
X0065:Psd2 UTSW 18 36002942 missense possibly damaging 0.92
Z1177:Psd2 UTSW 18 35978280 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCCACAGTGGATTTTCAGAG -3'
(R):5'- CCTTGAAAGCCTAGTGGGAG -3'

Sequencing Primer
(F):5'- CCACAGTGGATTTTCAGAGACCTG -3'
(R):5'- AAAGCCTAGTGGGAGCTCCTG -3'
Posted On2019-06-26