Incidental Mutation 'R7240:Iqca'
ID563119
Institutional Source Beutler Lab
Gene Symbol Iqca
Ensembl Gene ENSMUSG00000026301
Gene NameIQ motif containing with AAA domain
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location90042132-90153401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90070550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 567 (V567A)
Ref Sequence ENSEMBL: ENSMUSP00000148643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000212394]
Predicted Effect probably damaging
Transcript: ENSMUST00000113094
AA Change: V544A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: V544A

DomainStartEndE-ValueType
IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189011
Predicted Effect possibly damaging
Transcript: ENSMUST00000212394
AA Change: V567A

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Iqca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Iqca APN 1 90045657 missense probably benign 0.10
IGL01367:Iqca APN 1 90070628 splice site probably benign
IGL01545:Iqca APN 1 90045642 missense probably benign
IGL01797:Iqca APN 1 90144819 critical splice donor site probably null
IGL02098:Iqca APN 1 90047941 missense probably damaging 0.96
IGL02194:Iqca APN 1 90045663 missense probably benign 0.16
IGL03230:Iqca APN 1 90145002 missense probably damaging 1.00
IGL03259:Iqca APN 1 90052434 missense probably damaging 1.00
IGL03372:Iqca APN 1 90144969 missense possibly damaging 0.80
R0383:Iqca UTSW 1 90142707 missense probably damaging 1.00
R0610:Iqca UTSW 1 90142731 missense probably null 0.97
R0685:Iqca UTSW 1 90142731 missense probably null 0.97
R0798:Iqca UTSW 1 90142731 missense probably null 0.97
R0799:Iqca UTSW 1 90142731 missense probably null 0.97
R0800:Iqca UTSW 1 90142731 missense probably null 0.97
R0801:Iqca UTSW 1 90142731 missense probably null 0.97
R0825:Iqca UTSW 1 90142731 missense probably null 0.97
R0826:Iqca UTSW 1 90142731 missense probably null 0.97
R0827:Iqca UTSW 1 90142731 missense probably null 0.97
R0862:Iqca UTSW 1 90142731 missense probably null 0.97
R0863:Iqca UTSW 1 90142731 missense probably null 0.97
R0864:Iqca UTSW 1 90142731 missense probably null 0.97
R0960:Iqca UTSW 1 90142731 missense probably null 0.97
R0961:Iqca UTSW 1 90142731 missense probably null 0.97
R0962:Iqca UTSW 1 90142731 missense probably null 0.97
R0963:Iqca UTSW 1 90142731 missense probably null 0.97
R1101:Iqca UTSW 1 90142731 missense probably null 0.97
R1344:Iqca UTSW 1 90142731 missense probably null 0.97
R1523:Iqca UTSW 1 90142731 missense probably null 0.97
R1646:Iqca UTSW 1 90140038 missense probably damaging 0.98
R1682:Iqca UTSW 1 90142731 missense probably null 0.97
R1742:Iqca UTSW 1 90098051 missense probably benign 0.01
R1774:Iqca UTSW 1 90080903 missense probably benign 0.02
R1775:Iqca UTSW 1 90081416 missense probably damaging 1.00
R2011:Iqca UTSW 1 90045626 missense probably benign 0.00
R2065:Iqca UTSW 1 90130231 missense probably benign 0.01
R2156:Iqca UTSW 1 90089516 missense possibly damaging 0.78
R2186:Iqca UTSW 1 90081344 missense probably benign 0.06
R3872:Iqca UTSW 1 90089481 missense probably damaging 1.00
R4308:Iqca UTSW 1 90144897 missense probably damaging 1.00
R4578:Iqca UTSW 1 90073750 missense probably damaging 0.98
R4737:Iqca UTSW 1 90077822 missense probably damaging 0.99
R4867:Iqca UTSW 1 90089504 missense probably benign 0.00
R4884:Iqca UTSW 1 90140037 missense probably benign 0.10
R4887:Iqca UTSW 1 90045701 missense probably damaging 1.00
R5352:Iqca UTSW 1 90130196 missense probably benign 0.00
R5733:Iqca UTSW 1 90070535 missense probably damaging 0.97
R5838:Iqca UTSW 1 90144945 missense probably benign 0.22
R5951:Iqca UTSW 1 90140097 intron probably null
R5957:Iqca UTSW 1 90080948 missense probably damaging 1.00
R6696:Iqca UTSW 1 90130200 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGCAAGCACTATGGAAG -3'
(R):5'- CTAGGCTGTGTCAGGTCCATAG -3'

Sequencing Primer
(F):5'- CTATGGAAGAGAGACAAGGCTTCAC -3'
(R):5'- ATGAGTAGGACTGACGTGCTCC -3'
Posted On2019-06-26