Incidental Mutation 'R0578:Inppl1'
ID56312
Institutional Source Beutler Lab
Gene Symbol Inppl1
Ensembl Gene ENSMUSG00000032737
Gene Nameinositol polyphosphate phosphatase-like 1
SynonymsSHIP2
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101822632-101838229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101831588 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 355 (E355G)
Ref Sequence ENSEMBL: ENSMUSP00000139910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035836] [ENSMUST00000165052] [ENSMUST00000185929]
Predicted Effect probably benign
Transcript: ENSMUST00000035836
AA Change: E355G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737
AA Change: E355G

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165052
AA Change: E355G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737
AA Change: E355G

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185929
AA Change: E355G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737
AA Change: E355G

DomainStartEndE-ValueType
SH2 19 108 7.6e-29 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 4e-14 BLAST
IPPc 423 736 1.9e-139 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209861
Predicted Effect probably benign
Transcript: ENSMUST00000210116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211514
Meta Mutation Damage Score 0.1885 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice display decreased postnatal growth, decreased circulating levels of leptin, free fatty acids, triglycerides, and total cholesterol, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Inppl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Inppl1 APN 7 101829158 missense probably damaging 1.00
IGL01633:Inppl1 APN 7 101833834 nonsense probably null
IGL01678:Inppl1 APN 7 101832596 missense probably benign 0.09
IGL02420:Inppl1 APN 7 101832319 unclassified probably benign
IGL02423:Inppl1 APN 7 101832243 missense probably benign 0.02
IGL02965:Inppl1 APN 7 101828271 missense possibly damaging 0.87
IGL03329:Inppl1 APN 7 101824380 missense possibly damaging 0.48
PIT4362001:Inppl1 UTSW 7 101826013 missense probably benign 0.34
R0310:Inppl1 UTSW 7 101828499 splice site probably benign
R0355:Inppl1 UTSW 7 101827457 missense probably damaging 1.00
R0394:Inppl1 UTSW 7 101828195 splice site probably benign
R0547:Inppl1 UTSW 7 101831003 missense probably benign 0.02
R1506:Inppl1 UTSW 7 101823967 missense probably benign 0.01
R1526:Inppl1 UTSW 7 101832946 missense probably benign 0.02
R1901:Inppl1 UTSW 7 101823377 missense possibly damaging 0.85
R2381:Inppl1 UTSW 7 101829232 missense probably damaging 1.00
R3690:Inppl1 UTSW 7 101832068 missense probably damaging 0.99
R4911:Inppl1 UTSW 7 101832309 missense possibly damaging 0.94
R5637:Inppl1 UTSW 7 101828848 missense probably benign 0.08
R6227:Inppl1 UTSW 7 101824299 missense possibly damaging 0.88
R6409:Inppl1 UTSW 7 101828961 missense probably damaging 1.00
R6678:Inppl1 UTSW 7 101832270 missense probably damaging 0.99
R6752:Inppl1 UTSW 7 101832542 nonsense probably null
R7095:Inppl1 UTSW 7 101827456 nonsense probably null
R7196:Inppl1 UTSW 7 101828786 missense probably benign 0.05
R7421:Inppl1 UTSW 7 101832937 missense probably damaging 0.99
R7575:Inppl1 UTSW 7 101828482 missense probably damaging 1.00
R7664:Inppl1 UTSW 7 101830097 missense probably damaging 0.97
R7767:Inppl1 UTSW 7 101824338 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTCTGCACACGCTGGGATTTAATG -3'
(R):5'- TCTCTCTAGGCCCTAAAGGCACTG -3'

Sequencing Primer
(F):5'- GATTTAATGAGCTGCCGGAC -3'
(R):5'- GCCTTTGAGGTACATGGCAG -3'
Posted On2013-07-11