Incidental Mutation 'R7240:Olfr418'
ID563124
Institutional Source Beutler Lab
Gene Symbol Olfr418
Ensembl Gene ENSMUSG00000049605
Gene Nameolfactory receptor 418
SynonymsGA_x6K02T2P20D-20826777-20827719, MOR267-8, GA_x6K02T2R7CC-581296-580364, Olfr418-ps1, Olfr1403, MOR267-12P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173266001-173273994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173270994 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000150427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059754] [ENSMUST00000111224] [ENSMUST00000213420]
Predicted Effect probably benign
Transcript: ENSMUST00000059754
AA Change: I273T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052418
Gene: ENSMUSG00000049605
AA Change: I273T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-55 PFAM
Pfam:7tm_1 41 289 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111224
SMART Domains Protein: ENSMUSP00000106855
Gene: ENSMUSG00000079180

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PTX 20 219 1.93e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213420
AA Change: I273T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Olfr418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01418:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01930:Olfr418 APN 1 173270610 missense probably benign
IGL01963:Olfr418 APN 1 173270352 missense probably damaging 0.99
IGL02104:Olfr418 APN 1 173271036 missense probably damaging 0.96
IGL02192:Olfr418 APN 1 173270850 missense probably damaging 1.00
IGL02256:Olfr418 APN 1 173270627 missense probably benign 0.04
IGL02340:Olfr418 APN 1 173270405 missense probably benign 0.10
IGL02454:Olfr418 APN 1 173270940 missense probably damaging 0.99
IGL02638:Olfr418 APN 1 173270331 missense probably benign 0.07
FR4737:Olfr418 UTSW 1 173270630 frame shift probably null
FR4976:Olfr418 UTSW 1 173270630 frame shift probably null
R0552:Olfr418 UTSW 1 173270805 missense probably benign 0.05
R0621:Olfr418 UTSW 1 173270675 missense possibly damaging 0.48
R0735:Olfr418 UTSW 1 173271002 missense probably benign 0.05
R1506:Olfr418 UTSW 1 173270769 missense probably benign 0.04
R1670:Olfr418 UTSW 1 173270900 missense probably damaging 1.00
R2111:Olfr418 UTSW 1 173270312 missense probably benign
R2204:Olfr418 UTSW 1 173270136 splice site probably null
R4475:Olfr418 UTSW 1 173270913 missense probably damaging 0.99
R4909:Olfr418 UTSW 1 173270979 missense probably damaging 0.97
R5457:Olfr418 UTSW 1 173270574 missense probably benign 0.00
R6124:Olfr418 UTSW 1 173270279 missense probably damaging 1.00
R6456:Olfr418 UTSW 1 173270538 missense probably damaging 1.00
R7220:Olfr418 UTSW 1 173270244 missense possibly damaging 0.56
R7672:Olfr418 UTSW 1 173270873 missense probably benign 0.18
R8073:Olfr418 UTSW 1 173270985 missense probably benign 0.42
R8116:Olfr418 UTSW 1 173270480 missense possibly damaging 0.88
RF032:Olfr418 UTSW 1 173270709 frame shift probably null
RF036:Olfr418 UTSW 1 173270709 frame shift probably null
RF040:Olfr418 UTSW 1 173270709 frame shift probably null
X0019:Olfr418 UTSW 1 173270557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCAGCTCACTGGTTATTGTGGTAC -3'
(R):5'- GACTGTGATTAACTGAAACTGCAGG -3'

Sequencing Primer
(F):5'- CTCACTGGTTATTGTGGTACCCATG -3'
(R):5'- GTAAATAAAGGGAATCCACTGTACAC -3'
Posted On2019-06-26