Incidental Mutation 'R7240:Tmc2'
ID563130
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Nametransmembrane channel-like gene family 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130195194-130264445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130234804 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 350 (T350I)
Ref Sequence ENSEMBL: ENSMUSP00000077139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077988
AA Change: T350I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: T350I

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166774
AA Change: T350I

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: T350I

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130261304 missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130264012 missense probably benign 0.02
IGL01094:Tmc2 APN 2 130260166 splice site probably benign
IGL01331:Tmc2 APN 2 130232356 missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130260224 nonsense probably null
IGL01926:Tmc2 APN 2 130260240 missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130240153 missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130229206 missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130240130 missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130229187 missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130240196 missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130226262 missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130248651 missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130202103 missense probably benign 0.00
R1183:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130248730 missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130248762 missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130247960 missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130247934 missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130256116 missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130260225 missense probably benign 0.34
R1776:Tmc2 UTSW 2 130234869 missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130248756 missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130214664 splice site probably benign
R2020:Tmc2 UTSW 2 130232385 missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130214563 splice site probably null
R3968:Tmc2 UTSW 2 130202071 missense probably benign 0.02
R4732:Tmc2 UTSW 2 130261397 splice site probably null
R4733:Tmc2 UTSW 2 130261397 splice site probably null
R4989:Tmc2 UTSW 2 130202041 missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130234818 missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130240115 missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130241644 missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130232386 missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130264203 missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130261380 missense probably benign
R7132:Tmc2 UTSW 2 130232409 missense possibly damaging 0.82
R7353:Tmc2 UTSW 2 130196577 critical splice donor site probably null
X0019:Tmc2 UTSW 2 130208285 missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130201972 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACATCTGGGTACTCATAGGTAAC -3'
(R):5'- CTAGAGGGACCCAGAGTTTTC -3'

Sequencing Primer
(F):5'- TAAGACTGACCTAGGCCA -3'
(R):5'- TTTCTCGGGAAGGAGAGTCAGC -3'
Posted On2019-06-26