Incidental Mutation 'R7240:Tpst2'
ID563135
Institutional Source Beutler Lab
Gene Symbol Tpst2
Ensembl Gene ENSMUSG00000029344
Gene Nameprotein-tyrosine sulfotransferase 2
SynonymsD5Ucla3, grm, Tango13b, grt
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location112276691-112315361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112307678 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 28 (C28R)
Ref Sequence ENSEMBL: ENSMUSP00000031287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031287] [ENSMUST00000071455] [ENSMUST00000151947]
Predicted Effect probably benign
Transcript: ENSMUST00000031287
AA Change: C28R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031287
Gene: ENSMUSG00000029344
AA Change: C28R

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 272 8.8e-19 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071455
AA Change: C28R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071399
Gene: ENSMUSG00000029344
AA Change: C28R

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 276 8.4e-16 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140262
SMART Domains Protein: ENSMUSP00000116816
Gene: ENSMUSG00000029344

DomainStartEndE-ValueType
PDB:3AP2|B 2 63 4e-36 PDB
SCOP:d1fmja_ 3 55 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151947
AA Change: C28R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000198502
Meta Mutation Damage Score 0.3532 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the O-sulfation of tyrosine residues within acidic regions of proteins. The encoded protein is a type II integral membrane protein found in the Golgi body. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show a delayed rise and a prolonged deficit of pituitary growth hormone resulting in delayed pubertal growth, hypothyroidism, and an enlarged adenohypophysis with aberrant chromophobic cells. Homozygous null mice show a modest but transient pubertal growth lag and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Tpst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Tpst2 APN 5 112309858 missense probably damaging 1.00
IGL03268:Tpst2 APN 5 112308225 missense probably damaging 1.00
blooming UTSW 5 112307757 missense probably benign
gypsum UTSW 5 112308045 missense probably damaging 1.00
hot_springs UTSW 5 112307678 missense probably benign 0.05
R1175:Tpst2 UTSW 5 112308045 missense probably damaging 1.00
R1423:Tpst2 UTSW 5 112307622 missense probably benign 0.22
R1537:Tpst2 UTSW 5 112308420 missense possibly damaging 0.48
R2013:Tpst2 UTSW 5 112308014 missense probably damaging 1.00
R4624:Tpst2 UTSW 5 112308296 missense probably damaging 1.00
R4873:Tpst2 UTSW 5 112309821 nonsense probably null
R4875:Tpst2 UTSW 5 112309821 nonsense probably null
R5272:Tpst2 UTSW 5 112307952 missense probably damaging 1.00
R6123:Tpst2 UTSW 5 112308218 missense probably damaging 1.00
R6487:Tpst2 UTSW 5 112308123 missense probably damaging 1.00
R6605:Tpst2 UTSW 5 112276734 start gained probably benign
R6688:Tpst2 UTSW 5 112307757 missense probably benign
R7625:Tpst2 UTSW 5 112308021 missense probably damaging 1.00
R7777:Tpst2 UTSW 5 112309694 missense possibly damaging 0.53
R7797:Tpst2 UTSW 5 112307916 missense probably damaging 1.00
R8306:Tpst2 UTSW 5 112307937 missense probably damaging 1.00
R8486:Tpst2 UTSW 5 112308305 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCCAGCATCCTGTTTGTGTC -3'
(R):5'- CAGAATGAAGGCCTGCATGG -3'

Sequencing Primer
(F):5'- AGCATCCTGTTTGTGTCCCTATGG -3'
(R):5'- AGCTTCTCACGGCCAGACTTG -3'
Posted On2019-06-26