Incidental Mutation 'R7240:Cd69'
ID563140
Institutional Source Beutler Lab
Gene Symbol Cd69
Ensembl Gene ENSMUSG00000030156
Gene NameCD69 antigen
SynonymsVEA, AIM, 5830438K24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001033122; MGI: 88343

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location129267325-129275436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129270042 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 112 (S112T)
Ref Sequence ENSEMBL: ENSMUSP00000032259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032259] [ENSMUST00000204411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032259
AA Change: S112T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032259
Gene: ENSMUSG00000030156
AA Change: S112T

DomainStartEndE-ValueType
Blast:CLECT 3 42 3e-8 BLAST
low complexity region 44 61 N/A INTRINSIC
CLECT 85 195 3e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204411
AA Change: S71T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144734
Gene: ENSMUSG00000030156
AA Change: S71T

DomainStartEndE-ValueType
CLECT 44 154 1.5e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in slightly increased pre-B and immature B cell numbers in the bone marrow, and increased IgG2a and IgM response to T cell-dependent and T cell-independent antigens. Mutant mice were less prone to collagen inducedarthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Cd69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Cd69 APN 6 129268320 missense probably damaging 1.00
IGL02799:Cd69 APN 6 129268260 splice site probably benign
Jazzed UTSW 6 129269574 critical splice donor site probably null
Surrogate UTSW 6 129269580 missense probably benign 0.00
3-1:Cd69 UTSW 6 129275249 missense probably damaging 0.99
R0119:Cd69 UTSW 6 129270062 missense probably benign 0.01
R0136:Cd69 UTSW 6 129270062 missense probably benign 0.01
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R2327:Cd69 UTSW 6 129271388 missense probably damaging 1.00
R2352:Cd69 UTSW 6 129269604 missense probably damaging 1.00
R3955:Cd69 UTSW 6 129268380 splice site probably null
R4780:Cd69 UTSW 6 129271355 missense probably damaging 1.00
R5400:Cd69 UTSW 6 129269991 missense probably benign 0.01
R5522:Cd69 UTSW 6 129271416 missense probably damaging 0.97
R6594:Cd69 UTSW 6 129269574 critical splice donor site probably null
R6737:Cd69 UTSW 6 129268299 missense probably benign 0.04
R6972:Cd69 UTSW 6 129269580 missense probably benign 0.00
R7694:Cd69 UTSW 6 129270045 missense possibly damaging 0.91
Z1176:Cd69 UTSW 6 129268342 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCATACAGTGCTCCCTGC -3'
(R):5'- ACTCGGTTTACCTGTGGAGAG -3'

Sequencing Primer
(F):5'- GCCTCCACGACTAAGTTTCG -3'
(R):5'- TTCTTCTGTTACTAAGACAAATGTCC -3'
Posted On2019-06-26