Incidental Mutation 'R7240:Dpf1'
ID563142
Institutional Source Beutler Lab
Gene Symbol Dpf1
Ensembl Gene ENSMUSG00000030584
Gene NameD4, zinc and double PHD fingers family 1
Synonymsneuro-d4, Neud4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29303951-29318243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29311627 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 150 (F150L)
Ref Sequence ENSEMBL: ENSMUSP00000054385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049977] [ENSMUST00000065181] [ENSMUST00000108230] [ENSMUST00000108231]
Predicted Effect probably benign
Transcript: ENSMUST00000049977
AA Change: F150L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000054385
Gene: ENSMUSG00000030584
AA Change: F150L

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 1.6e-39 PFAM
ZnF_C2H2 196 219 2.4e-3 SMART
PHD 274 327 8.98e-7 SMART
RING 275 326 1.06e1 SMART
PHD 328 374 2.6e-12 SMART
RING 329 373 8.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065181
AA Change: F149L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000070539
Gene: ENSMUSG00000030584
AA Change: F149L

DomainStartEndE-ValueType
Pfam:Requiem_N 11 84 2e-39 PFAM
ZnF_C2H2 195 218 2.4e-3 SMART
PHD 273 326 8.98e-7 SMART
RING 274 325 1.06e1 SMART
PHD 327 373 2.6e-12 SMART
RING 328 372 8.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108230
AA Change: F149L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103865
Gene: ENSMUSG00000030584
AA Change: F149L

DomainStartEndE-ValueType
Pfam:Requiem_N 11 84 9.7e-40 PFAM
PHD 229 282 8.98e-7 SMART
RING 230 281 1.06e1 SMART
PHD 283 339 6.85e-12 SMART
RING 284 338 9.5e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108231
AA Change: F150L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103866
Gene: ENSMUSG00000030584
AA Change: F150L

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 1.2e-39 PFAM
ZnF_C2H2 196 219 2.4e-3 SMART
PHD 274 327 8.98e-7 SMART
RING 275 326 1.06e1 SMART
PHD 328 384 6.85e-12 SMART
RING 329 383 9.5e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137848
SMART Domains Protein: ENSMUSP00000120956
Gene: ENSMUSG00000030584

DomainStartEndE-ValueType
Pfam:Requiem_N 1 40 8.9e-20 PFAM
ZnF_C2H2 122 143 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142958
SMART Domains Protein: ENSMUSP00000117186
Gene: ENSMUSG00000030584

DomainStartEndE-ValueType
ZnF_C2H2 21 44 2.4e-3 SMART
PHD 82 135 8.98e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Dpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Dpf1 APN 7 29316556 unclassified probably benign
IGL00736:Dpf1 APN 7 29312908 nonsense probably null
IGL01804:Dpf1 APN 7 29316501 missense probably damaging 1.00
IGL01942:Dpf1 APN 7 29316502 missense probably damaging 1.00
IGL01953:Dpf1 APN 7 29314307 missense probably damaging 1.00
IGL03191:Dpf1 APN 7 29316561 unclassified probably benign
R3622:Dpf1 UTSW 7 29316206 splice site probably null
R3924:Dpf1 UTSW 7 29311673 missense possibly damaging 0.76
R4234:Dpf1 UTSW 7 29315632 missense probably damaging 1.00
R4606:Dpf1 UTSW 7 29316590 unclassified probably benign
R5379:Dpf1 UTSW 7 29304108 missense probably benign 0.02
R5434:Dpf1 UTSW 7 29311331 missense possibly damaging 0.92
R6185:Dpf1 UTSW 7 29311271 missense possibly damaging 0.92
R6672:Dpf1 UTSW 7 29316268 missense probably damaging 1.00
R6816:Dpf1 UTSW 7 29311662 missense possibly damaging 0.61
R7699:Dpf1 UTSW 7 29311607 missense possibly damaging 0.69
R7796:Dpf1 UTSW 7 29311681 missense possibly damaging 0.69
R8071:Dpf1 UTSW 7 29314141 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGCCTTCCTGCTCTGAGATG -3'
(R):5'- ACAGTTCTGATCCACAAGCTCC -3'

Sequencing Primer
(F):5'- TGCTCTGAGATGCCCGG -3'
(R):5'- GATCCACAAGCTCCATTTTCG -3'
Posted On2019-06-26