Incidental Mutation 'R7240:Iqgap1'
ID563143
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80759839 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 249 (N249K)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377] [ENSMUST00000205813]
Predicted Effect probably benign
Transcript: ENSMUST00000167377
AA Change: N249K

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: N249K

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205813
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80743888 missense probably benign 0.04
R8270:Iqgap1 UTSW 7 80730127 missense probably damaging 1.00
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCAAAACAAGTTCAATGC -3'
(R):5'- TCATTTTGTCTGTATAGTGTGCACC -3'

Sequencing Primer
(F):5'- TTCTGAGTTCAAGGACAGCC -3'
(R):5'- GCACCTATTGCCATCTATAATTACAG -3'
Posted On2019-06-26