Mutagenetix > Incidental Mutation

Incidental Mutation 'R7240:Sipa1l2'

563146

Institutional Source

Beutler Lab

Gene Symbol

Sipa1l2

Ensembl Gene

ENSMUSG00000001995

Gene Name

signal-induced proliferation-associated 1 like 2

Synonyms

MMRRC Submission

045347-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R7240 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125418063-125569808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125469860 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 712 (F712L)

Ref Sequence

ENSEMBL: ENSMUSP00000104405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]

AlphaFold

Q80TE4

Predicted Effect

probably damaging
Transcript: ENSMUST00000108775
AA Change: F712L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: F712L

Domain	Start	End	E-Value	Type
low complexity region	53	64	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
low complexity region	427	449	N/A	INTRINSIC
Pfam:Rap_GAP	625	807	2.6e-67	PFAM
PDZ	960	1026	6.47e-9	SMART
low complexity region	1091	1103	N/A	INTRINSIC
low complexity region	1120	1138	N/A	INTRINSIC
low complexity region	1220	1238	N/A	INTRINSIC
low complexity region	1299	1312	N/A	INTRINSIC
low complexity region	1321	1329	N/A	INTRINSIC
low complexity region	1334	1355	N/A	INTRINSIC
low complexity region	1404	1418	N/A	INTRINSIC
Pfam:SPAR_C	1421	1666	2.5e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212168
AA Change: F712L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212987
AA Change: F712L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210017I01Rik	A	G	3: 92,605,075	I59T	unknown	Het
Aspm	C	T	1: 139,478,651	Q1759*	probably null	Het
Atn1	A	T	6: 124,747,898	I124K	unknown	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Ccdc88c	C	T	12: 100,944,939	V879M	probably benign	Het
Cd300c	A	G	11: 114,959,783	C65R	possibly damaging	Het
Cd69	A	T	6: 129,270,042	S112T	possibly damaging	Het
Cdh19	T	C	1: 110,893,407	T534A	probably benign	Het
Cdk5rap2	T	A	4: 70,291,908	D701V	probably damaging	Het
D130052B06Rik	A	G	11: 33,623,874	H157R	possibly damaging	Het
Dpf1	T	A	7: 29,311,627	F150L	probably benign	Het
Dsg1c	T	C	18: 20,283,109	L689P	probably damaging	Het
Dstyk	G	A	1: 132,454,123	M538I	probably benign	Het
E4f1	T	A	17: 24,444,325	I669F	probably damaging	Het
Gm7138	T	C	10: 77,776,755	T64A	unknown	Het
Gnai2	A	C	9: 107,615,773	D310E		Het
Iqca	A	G	1: 90,070,550	V567A	possibly damaging	Het
Iqgap1	A	T	7: 80,759,839	N249K	probably benign	Het
Lamc1	A	G	1: 153,234,650	V1093A	possibly damaging	Het
Mfap3	A	G	11: 57,529,756	K188E	probably damaging	Het
N4bp2	T	A	5: 65,794,545	V431D	probably damaging	Het
Notch4	A	G	17: 34,576,471	T792A	probably benign	Het
Ntn4	A	G	10: 93,745,741	H592R	probably damaging	Het
Ofcc1	A	G	13: 40,208,841	C202R	probably benign	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr418	T	C	1: 173,270,994	I273T	probably benign	Het
Olfr476	T	C	7: 107,968,188	S264P	probably benign	Het
Olfr497	A	G	7: 108,422,933	M121V	probably damaging	Het
Olfr922	A	G	9: 38,815,713	D70G	probably benign	Het
Olfr938	A	T	9: 39,078,610	M45K	probably damaging	Het
Parpbp	G	A	10: 88,124,940	T228I	probably damaging	Het
Pcdhgb8	G	A	18: 37,763,703	V609M	probably damaging	Het
Pla2g4d	T	C	2: 120,270,349	N543S	probably damaging	Het
Puf60	A	G	15: 76,072,539		probably benign	Het
Rbm6	A	T	9: 107,852,896	D184E	probably damaging	Het
Rnase9	A	C	14: 51,038,979	S181A	probably benign	Het
Rnpc3	T	A	3: 113,616,831	R270S	probably damaging	Het
Rundc1	T	C	11: 101,431,548		probably null	Het
Ryr1	T	C	7: 29,052,015	S3715G	possibly damaging	Het
Scn3a	A	T	2: 65,469,042	D1373E	possibly damaging	Het
Serpina3k	T	G	12: 104,340,602	I31S	probably benign	Het
Slc22a29	A	G	19: 8,161,511	V529A	probably damaging	Het
Tdrd3	A	G	14: 87,458,803	N58S	probably benign	Het
Tmc2	C	T	2: 130,234,804	T350I	possibly damaging	Het
Tpst2	T	C	5: 112,307,678	C28R	probably benign	Het
Trbv21	A	T	6: 41,202,958	K69N	probably benign	Het
Trpm2	A	G	10: 77,935,876		probably null	Het
Ttn	A	G	2: 76,848,990	V10796A	unknown	Het
Ush2a	A	G	1: 188,911,661	T4407A	possibly damaging	Het
Vmn2r95	A	G	17: 18,451,963	H726R	probably benign	Het
Zfp777	A	G	6: 48,044,449	S80P	probably benign	Het

Other mutations in Sipa1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Sipa1l2	APN	8	125491806	missense	probably damaging	1.00
IGL00939:Sipa1l2	APN	8	125464435	splice site	probably benign
IGL00965:Sipa1l2	APN	8	125447874	missense	probably benign	0.02
IGL01321:Sipa1l2	APN	8	125491518	missense	probably damaging	1.00
IGL01450:Sipa1l2	APN	8	125422577	critical splice donor site	probably null
IGL01753:Sipa1l2	APN	8	125453292	splice site	probably benign
IGL01930:Sipa1l2	APN	8	125419239	missense	probably damaging	0.99
IGL02041:Sipa1l2	APN	8	125491819	missense	probably benign	0.03
IGL02215:Sipa1l2	APN	8	125447837	missense	possibly damaging	0.67
IGL02272:Sipa1l2	APN	8	125492011	missense	probably damaging	1.00
IGL02370:Sipa1l2	APN	8	125480269	missense	probably damaging	1.00
IGL02538:Sipa1l2	APN	8	125451977	missense	probably damaging	1.00
IGL02633:Sipa1l2	APN	8	125447768	missense	probably damaging	1.00
IGL03394:Sipa1l2	APN	8	125491659	missense	possibly damaging	0.67
Rebellious	UTSW	8	125468339	missense	probably benign	0.01
R0144:Sipa1l2	UTSW	8	125449876	splice site	probably null
R0153:Sipa1l2	UTSW	8	125421898	missense	probably damaging	0.99
R0276:Sipa1l2	UTSW	8	125421940	missense	probably damaging	1.00
R0318:Sipa1l2	UTSW	8	125447697	missense	possibly damaging	0.73
R0373:Sipa1l2	UTSW	8	125464410	missense	probably damaging	0.99
R0427:Sipa1l2	UTSW	8	125480332	missense	probably damaging	1.00
R0634:Sipa1l2	UTSW	8	125422624	nonsense	probably null
R1377:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1435:Sipa1l2	UTSW	8	125468725	missense	probably damaging	1.00
R1523:Sipa1l2	UTSW	8	125447613	missense	possibly damaging	0.75
R1577:Sipa1l2	UTSW	8	125492262	missense	probably benign	0.00
R1581:Sipa1l2	UTSW	8	125491617	missense	probably damaging	0.96
R1583:Sipa1l2	UTSW	8	125421895	missense	probably damaging	0.97
R1719:Sipa1l2	UTSW	8	125444535	missense	probably damaging	0.99
R1730:Sipa1l2	UTSW	8	125480141	splice site	probably null
R1940:Sipa1l2	UTSW	8	125480148	splice site	probably benign
R2007:Sipa1l2	UTSW	8	125439437	missense	probably damaging	1.00
R2141:Sipa1l2	UTSW	8	125491491	missense	probably benign	0.07
R2203:Sipa1l2	UTSW	8	125491627	missense	probably damaging	0.99
R2764:Sipa1l2	UTSW	8	125492374	missense	probably damaging	0.99
R3722:Sipa1l2	UTSW	8	125473584	missense	probably damaging	1.00
R3787:Sipa1l2	UTSW	8	125423205	missense	probably benign
R3787:Sipa1l2	UTSW	8	125450383	missense	possibly damaging	0.52
R4106:Sipa1l2	UTSW	8	125492308	missense	probably damaging	1.00
R4117:Sipa1l2	UTSW	8	125468510	missense	probably damaging	1.00
R4194:Sipa1l2	UTSW	8	125491672	missense	probably benign	0.00
R4237:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4240:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4448:Sipa1l2	UTSW	8	125492355	missense	probably damaging	1.00
R4515:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4519:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4523:Sipa1l2	UTSW	8	125492424	missense	probably damaging	1.00
R4557:Sipa1l2	UTSW	8	125464415	missense	probably damaging	0.98
R4667:Sipa1l2	UTSW	8	125453470	missense	possibly damaging	0.93
R4687:Sipa1l2	UTSW	8	125491245	missense	probably damaging	1.00
R4854:Sipa1l2	UTSW	8	125473601	missense	probably damaging	1.00
R4890:Sipa1l2	UTSW	8	125491867	missense	probably damaging	1.00
R5065:Sipa1l2	UTSW	8	125491585	missense	probably benign	0.19
R5194:Sipa1l2	UTSW	8	125439273	missense	possibly damaging	0.48
R5266:Sipa1l2	UTSW	8	125492126	missense	probably damaging	0.99
R5475:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R5718:Sipa1l2	UTSW	8	125491248	missense	probably damaging	1.00
R5910:Sipa1l2	UTSW	8	125491684	missense	probably benign	0.42
R5916:Sipa1l2	UTSW	8	125468573	missense	probably damaging	1.00
R5941:Sipa1l2	UTSW	8	125473536	missense	probably damaging	0.99
R6083:Sipa1l2	UTSW	8	125468473	missense	possibly damaging	0.87
R6185:Sipa1l2	UTSW	8	125468253	nonsense	probably null
R6235:Sipa1l2	UTSW	8	125474871	missense	probably damaging	1.00
R6274:Sipa1l2	UTSW	8	125469872	missense	probably damaging	1.00
R6299:Sipa1l2	UTSW	8	125453464	missense	possibly damaging	0.75
R6374:Sipa1l2	UTSW	8	125444630	missense	probably damaging	1.00
R6459:Sipa1l2	UTSW	8	125444484	critical splice donor site	probably null
R6462:Sipa1l2	UTSW	8	125491230	missense	probably damaging	1.00
R6496:Sipa1l2	UTSW	8	125449894	missense	probably benign	0.00
R6543:Sipa1l2	UTSW	8	125450362	missense	possibly damaging	0.50
R7154:Sipa1l2	UTSW	8	125468339	missense	probably benign	0.01
R7192:Sipa1l2	UTSW	8	125422609	missense	probably benign	0.09
R7361:Sipa1l2	UTSW	8	125453332	missense	probably damaging	1.00
R7383:Sipa1l2	UTSW	8	125447646	missense	probably damaging	1.00
R7417:Sipa1l2	UTSW	8	125482106	missense	possibly damaging	0.93
R7604:Sipa1l2	UTSW	8	125419272	missense	probably benign	0.45
R7658:Sipa1l2	UTSW	8	125492290	missense	probably benign	0.00
R7743:Sipa1l2	UTSW	8	125464233	missense	probably damaging	1.00
R7781:Sipa1l2	UTSW	8	125491827	missense	possibly damaging	0.46
R7812:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R7829:Sipa1l2	UTSW	8	125451988	missense	probably damaging	1.00
R7880:Sipa1l2	UTSW	8	125464393	missense	probably damaging	1.00
R7884:Sipa1l2	UTSW	8	125447598	missense	probably benign
R8057:Sipa1l2	UTSW	8	125468530	missense	probably damaging	1.00
R8082:Sipa1l2	UTSW	8	125491809	missense	possibly damaging	0.82
R8092:Sipa1l2	UTSW	8	125419168	missense	probably benign	0.03
R8247:Sipa1l2	UTSW	8	125422633	missense	probably benign	0.29
R8252:Sipa1l2	UTSW	8	125468671	missense	probably damaging	1.00
R8386:Sipa1l2	UTSW	8	125492093	missense	probably damaging	1.00
R8466:Sipa1l2	UTSW	8	125492246	missense	probably damaging	1.00
R8697:Sipa1l2	UTSW	8	125482116	missense	probably damaging	1.00
R8725:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R8727:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R9048:Sipa1l2	UTSW	8	125447726	missense	possibly damaging	0.59
R9224:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R9279:Sipa1l2	UTSW	8	125482157	missense	probably damaging	1.00
R9392:Sipa1l2	UTSW	8	125468221	missense	probably benign
R9574:Sipa1l2	UTSW	8	125442714	missense	probably benign
R9591:Sipa1l2	UTSW	8	125492373	missense	probably damaging	0.99
R9614:Sipa1l2	UTSW	8	125469826	missense	probably null	0.01
R9690:Sipa1l2	UTSW	8	125492257	missense	probably benign
X0027:Sipa1l2	UTSW	8	125492136	missense	probably damaging	1.00
Z1177:Sipa1l2	UTSW	8	125447556	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- TCAGCCTAGACTATACAGTGGGG -3'
(R):5'- AAGGGCTCTGCTTGTCTCTG -3'

Sequencing Primer
(F):5'- CCTAGACTATACAGTGGGGGAGGG -3'
(R):5'- TGTTCCTTTCTCGGCTGAG -3'

Posted On

2019-06-26