Mutagenetix > Incidental Mutation

Incidental Mutation 'R7240:Trpm2'

563152

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R7240 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 77935876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

probably null
Transcript: ENSMUST00000105401

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210017I01Rik	A	G	3: 92,605,075	I59T	unknown	Het
Aspm	C	T	1: 139,478,651	Q1759*	probably null	Het
Atn1	A	T	6: 124,747,898	I124K	unknown	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Ccdc88c	C	T	12: 100,944,939	V879M	probably benign	Het
Cd300c	A	G	11: 114,959,783	C65R	possibly damaging	Het
Cd69	A	T	6: 129,270,042	S112T	possibly damaging	Het
Cdh19	T	C	1: 110,893,407	T534A	probably benign	Het
Cdk5rap2	T	A	4: 70,291,908	D701V	probably damaging	Het
D130052B06Rik	A	G	11: 33,623,874	H157R	possibly damaging	Het
Dpf1	T	A	7: 29,311,627	F150L	probably benign	Het
Dsg1c	T	C	18: 20,283,109	L689P	probably damaging	Het
Dstyk	G	A	1: 132,454,123	M538I	probably benign	Het
E4f1	T	A	17: 24,444,325	I669F	probably damaging	Het
Gm7138	T	C	10: 77,776,755	T64A	unknown	Het
Gnai2	A	C	9: 107,615,773	D310E		Het
Iqca	A	G	1: 90,070,550	V567A	possibly damaging	Het
Iqgap1	A	T	7: 80,759,839	N249K	probably benign	Het
Lamc1	A	G	1: 153,234,650	V1093A	possibly damaging	Het
Mfap3	A	G	11: 57,529,756	K188E	probably damaging	Het
N4bp2	T	A	5: 65,794,545	V431D	probably damaging	Het
Notch4	A	G	17: 34,576,471	T792A	probably benign	Het
Ntn4	A	G	10: 93,745,741	H592R	probably damaging	Het
Ofcc1	A	G	13: 40,208,841	C202R	probably benign	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr418	T	C	1: 173,270,994	I273T	probably benign	Het
Olfr476	T	C	7: 107,968,188	S264P	probably benign	Het
Olfr497	A	G	7: 108,422,933	M121V	probably damaging	Het
Olfr922	A	G	9: 38,815,713	D70G	probably benign	Het
Olfr938	A	T	9: 39,078,610	M45K	probably damaging	Het
Parpbp	G	A	10: 88,124,940	T228I	probably damaging	Het
Pcdhgb8	G	A	18: 37,763,703	V609M	probably damaging	Het
Pla2g4d	T	C	2: 120,270,349	N543S	probably damaging	Het
Puf60	A	G	15: 76,072,539		probably benign	Het
Rbm6	A	T	9: 107,852,896	D184E	probably damaging	Het
Rnase9	A	C	14: 51,038,979	S181A	probably benign	Het
Rnpc3	T	A	3: 113,616,831	R270S	probably damaging	Het
Rundc1	T	C	11: 101,431,548		probably null	Het
Ryr1	T	C	7: 29,052,015	S3715G	possibly damaging	Het
Scn3a	A	T	2: 65,469,042	D1373E	possibly damaging	Het
Serpina3k	T	G	12: 104,340,602	I31S	probably benign	Het
Sipa1l2	A	G	8: 125,469,860	F712L	probably damaging	Het
Slc22a29	A	G	19: 8,161,511	V529A	probably damaging	Het
Tdrd3	A	G	14: 87,458,803	N58S	probably benign	Het
Tmc2	C	T	2: 130,234,804	T350I	possibly damaging	Het
Tpst2	T	C	5: 112,307,678	C28R	probably benign	Het
Trbv21	A	T	6: 41,202,958	K69N	probably benign	Het
Ttn	A	G	2: 76,848,990	V10796A	unknown	Het
Ush2a	A	G	1: 188,911,661	T4407A	possibly damaging	Het
Vmn2r95	A	G	17: 18,451,963	H726R	probably benign	Het
Zfp777	A	G	6: 48,044,449	S80P	probably benign	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77911392	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGTGACCACAGCAGATTGC -3'
(R):5'- TGGGACATGAATTGTTCTCTGC -3'

Sequencing Primer
(F):5'- AGAGGCCCTGAGTTCAATTC -3'
(R):5'- TCTCTGCCTATCAGGTGCAGG -3'

Posted On

2019-06-26