Incidental Mutation 'R7240:Parpbp'
ID563153
Institutional Source Beutler Lab
Gene Symbol Parpbp
Ensembl Gene ENSMUSG00000035365
Gene NamePARP1 binding protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88091432-88146941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88124940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 228 (T228I)
Ref Sequence ENSEMBL: ENSMUSP00000038375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048518] [ENSMUST00000164121] [ENSMUST00000168163]
Predicted Effect probably damaging
Transcript: ENSMUST00000048518
AA Change: T228I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038375
Gene: ENSMUSG00000035365
AA Change: T228I

DomainStartEndE-ValueType
SCOP:d1pjr_2 154 268 8e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164121
SMART Domains Protein: ENSMUSP00000130777
Gene: ENSMUSG00000035365

DomainStartEndE-ValueType
SCOP:d1pjr_2 154 202 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Parpbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Parpbp APN 10 88139986 nonsense probably null
IGL02058:Parpbp APN 10 88144036 missense probably benign 0.03
IGL02222:Parpbp APN 10 88140085 missense possibly damaging 0.95
IGL02976:Parpbp APN 10 88111594 critical splice donor site probably null
IGL03013:Parpbp APN 10 88139978 missense probably damaging 0.96
PIT4468001:Parpbp UTSW 10 88144073 missense probably benign 0.00
PIT4544001:Parpbp UTSW 10 88114549 missense possibly damaging 0.90
R0145:Parpbp UTSW 10 88093009 missense possibly damaging 0.76
R0201:Parpbp UTSW 10 88092896 missense possibly damaging 0.46
R0471:Parpbp UTSW 10 88093707 missense probably damaging 0.96
R2057:Parpbp UTSW 10 88124962 missense probably benign 0.00
R2350:Parpbp UTSW 10 88133088 splice site probably benign
R4551:Parpbp UTSW 10 88093702 missense possibly damaging 0.82
R4552:Parpbp UTSW 10 88093702 missense possibly damaging 0.82
R5843:Parpbp UTSW 10 88133191 missense probably damaging 1.00
R5951:Parpbp UTSW 10 88139907 missense probably damaging 0.99
R6003:Parpbp UTSW 10 88133158 missense possibly damaging 0.71
R6656:Parpbp UTSW 10 88110313 missense probably benign
R7081:Parpbp UTSW 10 88093655 missense probably damaging 0.99
R7334:Parpbp UTSW 10 88111755 missense probably damaging 0.99
R7615:Parpbp UTSW 10 88093637 missense probably damaging 0.96
R8025:Parpbp UTSW 10 88093108 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GATGCTTGGTGATTTCAGTATTACC -3'
(R):5'- TCCTTAGCGTGTGACATGGC -3'

Sequencing Primer
(F):5'- ATTCCTACCTCTGAATCTGTGAAG -3'
(R):5'- ACATGGCCCATGAAGTGTGC -3'
Posted On2019-06-26