Incidental Mutation 'R7240:D130052B06Rik'
ID 563155
Institutional Source Beutler Lab
Gene Symbol D130052B06Rik
Ensembl Gene ENSMUSG00000073052
Gene Name RIKEN cDNA D130052B06 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R7240 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 33599302-33625618 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33623874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 157 (H157R)
Ref Sequence ENSEMBL: ENSMUSP00000098922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101371]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000101371
AA Change: H157R

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098922
Gene: ENSMUSG00000073052
AA Change: H157R

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
internal_repeat_2 36 101 5.51e-11 PROSPERO
internal_repeat_1 68 122 4.83e-23 PROSPERO
internal_repeat_2 99 175 5.51e-11 PROSPERO
internal_repeat_1 122 176 4.83e-23 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in D130052B06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:D130052B06Rik APN 11 33623558 missense possibly damaging 0.62
IGL00508:D130052B06Rik APN 11 33599402 missense unknown
IGL01152:D130052B06Rik APN 11 33623620 splice site probably null
IGL01744:D130052B06Rik APN 11 33623966 missense unknown
IGL02829:D130052B06Rik APN 11 33623864 missense probably benign 0.16
IGL02882:D130052B06Rik APN 11 33623780 missense probably damaging 0.99
R0396:D130052B06Rik UTSW 11 33623391 missense unknown
R0571:D130052B06Rik UTSW 11 33623922 missense probably benign 0.00
R1467:D130052B06Rik UTSW 11 33623622 splice site probably benign
R1706:D130052B06Rik UTSW 11 33616230 missense unknown
R1733:D130052B06Rik UTSW 11 33623784 missense probably benign 0.16
R6029:D130052B06Rik UTSW 11 33623477 missense possibly damaging 0.62
R6045:D130052B06Rik UTSW 11 33624008 missense unknown
R6269:D130052B06Rik UTSW 11 33623916 missense possibly damaging 0.92
R7238:D130052B06Rik UTSW 11 33623594 missense probably benign 0.01
R7305:D130052B06Rik UTSW 11 33623355 frame shift probably null
R9013:D130052B06Rik UTSW 11 33623491 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTGGTGACCCGTCTACAC -3'
(R):5'- GTCTCAAAAGAGACTTTGGACTC -3'

Sequencing Primer
(F):5'- ACCGTCCTGTACTGGTGATCTG -3'
(R):5'- GAGACTTTGGACTCTTGAACAATG -3'
Posted On 2019-06-26