Mutagenetix > Incidental Mutation

Incidental Mutation 'R7240:Ccdc88c'

563159

Institutional Source

Beutler Lab

Gene Symbol

Ccdc88c

Ensembl Gene

ENSMUSG00000021182

Gene Name

coiled-coil domain containing 88C

Synonyms

0610010D24Rik, Daple

MMRRC Submission

045347-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7240 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100911523-101029056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 100944939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 879 (V879M)

Ref Sequence

ENSEMBL: ENSMUSP00000068629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096] [ENSMUST00000223235]

AlphaFold

Q6VGS5

Predicted Effect

probably benign
Transcript: ENSMUST00000068411
AA Change: V879M

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: V879M

Domain	Start	End	E-Value	Type
Pfam:HOOK	7	586	5.9e-37	PFAM
low complexity region	601	613	N/A	INTRINSIC
low complexity region	617	634	N/A	INTRINSIC
Blast:BRLZ	668	719	3e-8	BLAST
low complexity region	724	744	N/A	INTRINSIC
low complexity region	827	837	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
Blast:BRLZ	948	1007	6e-15	BLAST
coiled coil region	1035	1085	N/A	INTRINSIC
low complexity region	1095	1110	N/A	INTRINSIC
coiled coil region	1129	1252	N/A	INTRINSIC
coiled coil region	1312	1384	N/A	INTRINSIC
low complexity region	1430	1439	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
low complexity region	1698	1709	N/A	INTRINSIC
internal_repeat_1	1721	1778	6.97e-6	PROSPERO
low complexity region	1788	1808	N/A	INTRINSIC
internal_repeat_1	1934	1989	6.97e-6	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000085096
AA Change: V886M

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: V886M

Domain	Start	End	E-Value	Type
Pfam:HOOK	13	597	2.5e-41	PFAM
low complexity region	608	620	N/A	INTRINSIC
low complexity region	624	641	N/A	INTRINSIC
Blast:BRLZ	675	726	3e-8	BLAST
low complexity region	731	751	N/A	INTRINSIC
low complexity region	834	844	N/A	INTRINSIC
low complexity region	854	873	N/A	INTRINSIC
Blast:BRLZ	955	1014	5e-15	BLAST
coiled coil region	1042	1092	N/A	INTRINSIC
low complexity region	1102	1117	N/A	INTRINSIC
coiled coil region	1136	1259	N/A	INTRINSIC
coiled coil region	1319	1391	N/A	INTRINSIC
low complexity region	1437	1446	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1569	1590	N/A	INTRINSIC
low complexity region	1705	1716	N/A	INTRINSIC
internal_repeat_1	1728	1785	6.57e-6	PROSPERO
low complexity region	1795	1815	N/A	INTRINSIC
internal_repeat_1	1941	1996	6.57e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000223235
AA Change: V79M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210017I01Rik	A	G	3: 92,605,075	I59T	unknown	Het
Aspm	C	T	1: 139,478,651	Q1759*	probably null	Het
Atn1	A	T	6: 124,747,898	I124K	unknown	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Cd300c	A	G	11: 114,959,783	C65R	possibly damaging	Het
Cd69	A	T	6: 129,270,042	S112T	possibly damaging	Het
Cdh19	T	C	1: 110,893,407	T534A	probably benign	Het
Cdk5rap2	T	A	4: 70,291,908	D701V	probably damaging	Het
D130052B06Rik	A	G	11: 33,623,874	H157R	possibly damaging	Het
Dpf1	T	A	7: 29,311,627	F150L	probably benign	Het
Dsg1c	T	C	18: 20,283,109	L689P	probably damaging	Het
Dstyk	G	A	1: 132,454,123	M538I	probably benign	Het
E4f1	T	A	17: 24,444,325	I669F	probably damaging	Het
Gm7138	T	C	10: 77,776,755	T64A	unknown	Het
Gnai2	A	C	9: 107,615,773	D310E		Het
Iqca	A	G	1: 90,070,550	V567A	possibly damaging	Het
Iqgap1	A	T	7: 80,759,839	N249K	probably benign	Het
Lamc1	A	G	1: 153,234,650	V1093A	possibly damaging	Het
Mfap3	A	G	11: 57,529,756	K188E	probably damaging	Het
N4bp2	T	A	5: 65,794,545	V431D	probably damaging	Het
Notch4	A	G	17: 34,576,471	T792A	probably benign	Het
Ntn4	A	G	10: 93,745,741	H592R	probably damaging	Het
Ofcc1	A	G	13: 40,208,841	C202R	probably benign	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr418	T	C	1: 173,270,994	I273T	probably benign	Het
Olfr476	T	C	7: 107,968,188	S264P	probably benign	Het
Olfr497	A	G	7: 108,422,933	M121V	probably damaging	Het
Olfr922	A	G	9: 38,815,713	D70G	probably benign	Het
Olfr938	A	T	9: 39,078,610	M45K	probably damaging	Het
Parpbp	G	A	10: 88,124,940	T228I	probably damaging	Het
Pcdhgb8	G	A	18: 37,763,703	V609M	probably damaging	Het
Pla2g4d	T	C	2: 120,270,349	N543S	probably damaging	Het
Puf60	A	G	15: 76,072,539		probably benign	Het
Rbm6	A	T	9: 107,852,896	D184E	probably damaging	Het
Rnase9	A	C	14: 51,038,979	S181A	probably benign	Het
Rnpc3	T	A	3: 113,616,831	R270S	probably damaging	Het
Rundc1	T	C	11: 101,431,548		probably null	Het
Ryr1	T	C	7: 29,052,015	S3715G	possibly damaging	Het
Scn3a	A	T	2: 65,469,042	D1373E	possibly damaging	Het
Serpina3k	T	G	12: 104,340,602	I31S	probably benign	Het
Sipa1l2	A	G	8: 125,469,860	F712L	probably damaging	Het
Slc22a29	A	G	19: 8,161,511	V529A	probably damaging	Het
Tdrd3	A	G	14: 87,458,803	N58S	probably benign	Het
Tmc2	C	T	2: 130,234,804	T350I	possibly damaging	Het
Tpst2	T	C	5: 112,307,678	C28R	probably benign	Het
Trbv21	A	T	6: 41,202,958	K69N	probably benign	Het
Trpm2	A	G	10: 77,935,876		probably null	Het
Ttn	A	G	2: 76,848,990	V10796A	unknown	Het
Ush2a	A	G	1: 188,911,661	T4407A	possibly damaging	Het
Vmn2r95	A	G	17: 18,451,963	H726R	probably benign	Het
Zfp777	A	G	6: 48,044,449	S80P	probably benign	Het

Other mutations in Ccdc88c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01112:Ccdc88c	APN	12	100916803	missense	probably benign	0.04
IGL02016:Ccdc88c	APN	12	100941207	missense	possibly damaging	0.63
IGL02031:Ccdc88c	APN	12	100933311	missense	probably damaging	0.98
IGL02133:Ccdc88c	APN	12	100940090	missense	probably damaging	1.00
IGL02427:Ccdc88c	APN	12	100921592	missense	probably damaging	1.00
IGL02494:Ccdc88c	APN	12	100945475	missense	probably benign
IGL02496:Ccdc88c	APN	12	100953293	missense	probably benign	0.05
IGL02549:Ccdc88c	APN	12	100928932	missense	probably benign	0.18
IGL02618:Ccdc88c	APN	12	100913553	missense	probably benign	0.28
IGL02626:Ccdc88c	APN	12	100967800	unclassified	probably benign
IGL03142:Ccdc88c	APN	12	100947198	missense	probably damaging	1.00
BB010:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
BB020:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R0127:Ccdc88c	UTSW	12	100935740	missense	possibly damaging	0.88
R0533:Ccdc88c	UTSW	12	100954282	missense	probably damaging	1.00
R0545:Ccdc88c	UTSW	12	100947188	missense	probably damaging	1.00
R0866:Ccdc88c	UTSW	12	100913192	missense	probably benign	0.01
R1230:Ccdc88c	UTSW	12	100948488	missense	probably benign	0.00
R1434:Ccdc88c	UTSW	12	100939166	splice site	probably benign
R1614:Ccdc88c	UTSW	12	100912984	missense	probably benign	0.00
R1644:Ccdc88c	UTSW	12	100913474	missense	probably damaging	0.98
R1712:Ccdc88c	UTSW	12	100939025	missense	probably benign	0.14
R2107:Ccdc88c	UTSW	12	100921549	missense	probably benign
R3612:Ccdc88c	UTSW	12	100939073	missense	probably damaging	0.99
R3724:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3737:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3743:Ccdc88c	UTSW	12	100948584	missense	probably damaging	1.00
R3772:Ccdc88c	UTSW	12	100966100	unclassified	probably benign
R3776:Ccdc88c	UTSW	12	100947179	missense	probably damaging	0.97
R3917:Ccdc88c	UTSW	12	100941107	critical splice donor site	probably null
R4034:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4035:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4110:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4113:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4270:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4271:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4520:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4521:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4522:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4523:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4524:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4717:Ccdc88c	UTSW	12	100916666	missense	probably benign	0.00
R4821:Ccdc88c	UTSW	12	100938079	missense	probably benign	0.00
R4823:Ccdc88c	UTSW	12	100930543	missense	probably damaging	1.00
R5090:Ccdc88c	UTSW	12	100954180	missense	probably damaging	1.00
R5510:Ccdc88c	UTSW	12	100945031	missense	probably damaging	1.00
R5514:Ccdc88c	UTSW	12	100913439	missense	probably damaging	1.00
R5903:Ccdc88c	UTSW	12	100930542	missense	probably damaging	1.00
R5999:Ccdc88c	UTSW	12	100968354	missense	probably damaging	1.00
R6131:Ccdc88c	UTSW	12	100941128	missense	probably damaging	1.00
R6164:Ccdc88c	UTSW	12	100953383	missense	probably damaging	0.98
R6971:Ccdc88c	UTSW	12	100954227	missense	probably damaging	1.00
R6998:Ccdc88c	UTSW	12	100916852	missense	probably damaging	0.96
R7031:Ccdc88c	UTSW	12	100945064	missense	probably damaging	1.00
R7366:Ccdc88c	UTSW	12	100944950	missense	possibly damaging	0.89
R7604:Ccdc88c	UTSW	12	100930547	missense	probably damaging	1.00
R7674:Ccdc88c	UTSW	12	100945232	missense	probably benign	0.00
R7795:Ccdc88c	UTSW	12	100923311	missense	probably benign	0.32
R7933:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R7990:Ccdc88c	UTSW	12	100967985	missense	probably damaging	1.00
R8339:Ccdc88c	UTSW	12	100941140	nonsense	probably null
R8734:Ccdc88c	UTSW	12	100940135	missense	probably damaging	1.00
R8778:Ccdc88c	UTSW	12	100945224	missense	probably benign	0.25
R8925:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R8927:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R9014:Ccdc88c	UTSW	12	100913064	missense	probably benign	0.09
R9204:Ccdc88c	UTSW	12	100938063	missense	unknown
R9257:Ccdc88c	UTSW	12	100923215	missense	possibly damaging	0.94
R9326:Ccdc88c	UTSW	12	101028850	start gained	probably benign
R9424:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R9439:Ccdc88c	UTSW	12	100918338	missense	probably benign	0.25
R9539:Ccdc88c	UTSW	12	100935734	missense	possibly damaging	0.89
R9576:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
Z1176:Ccdc88c	UTSW	12	100945770	missense	possibly damaging	0.69
Z1177:Ccdc88c	UTSW	12	100945155	missense	probably benign
Z1190:Ccdc88c	UTSW	12	100923332	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAGGACACACCAAGATCTC -3'
(R):5'- TAGAGACTCTCCAGCTCACC -3'

Sequencing Primer
(F):5'- AGATCTCCCTGAACCTCCC -3'
(R):5'- ACCCACAAGCAGCTGGAGG -3'

Posted On

2019-06-26