Incidental Mutation 'R7240:Ccdc88c'
ID 563159
Institutional Source Beutler Lab
Gene Symbol Ccdc88c
Ensembl Gene ENSMUSG00000021182
Gene Name coiled-coil domain containing 88C
Synonyms 0610010D24Rik, Daple
MMRRC Submission 045347-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7240 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 100911523-101029056 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100944939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 879 (V879M)
Ref Sequence ENSEMBL: ENSMUSP00000068629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096] [ENSMUST00000223235]
AlphaFold Q6VGS5
Predicted Effect probably benign
Transcript: ENSMUST00000068411
AA Change: V879M

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: V879M

DomainStartEndE-ValueType
Pfam:HOOK 7 586 5.9e-37 PFAM
low complexity region 601 613 N/A INTRINSIC
low complexity region 617 634 N/A INTRINSIC
Blast:BRLZ 668 719 3e-8 BLAST
low complexity region 724 744 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
Blast:BRLZ 948 1007 6e-15 BLAST
coiled coil region 1035 1085 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1129 1252 N/A INTRINSIC
coiled coil region 1312 1384 N/A INTRINSIC
low complexity region 1430 1439 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
low complexity region 1698 1709 N/A INTRINSIC
internal_repeat_1 1721 1778 6.97e-6 PROSPERO
low complexity region 1788 1808 N/A INTRINSIC
internal_repeat_1 1934 1989 6.97e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085096
AA Change: V886M

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: V886M

DomainStartEndE-ValueType
Pfam:HOOK 13 597 2.5e-41 PFAM
low complexity region 608 620 N/A INTRINSIC
low complexity region 624 641 N/A INTRINSIC
Blast:BRLZ 675 726 3e-8 BLAST
low complexity region 731 751 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 854 873 N/A INTRINSIC
Blast:BRLZ 955 1014 5e-15 BLAST
coiled coil region 1042 1092 N/A INTRINSIC
low complexity region 1102 1117 N/A INTRINSIC
coiled coil region 1136 1259 N/A INTRINSIC
coiled coil region 1319 1391 N/A INTRINSIC
low complexity region 1437 1446 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1569 1590 N/A INTRINSIC
low complexity region 1705 1716 N/A INTRINSIC
internal_repeat_1 1728 1785 6.57e-6 PROSPERO
low complexity region 1795 1815 N/A INTRINSIC
internal_repeat_1 1941 1996 6.57e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000223235
AA Change: V79M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dsg1c T C 18: 20,283,109 L689P probably damaging Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Ccdc88c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ccdc88c APN 12 100916803 missense probably benign 0.04
IGL02016:Ccdc88c APN 12 100941207 missense possibly damaging 0.63
IGL02031:Ccdc88c APN 12 100933311 missense probably damaging 0.98
IGL02133:Ccdc88c APN 12 100940090 missense probably damaging 1.00
IGL02427:Ccdc88c APN 12 100921592 missense probably damaging 1.00
IGL02494:Ccdc88c APN 12 100945475 missense probably benign
IGL02496:Ccdc88c APN 12 100953293 missense probably benign 0.05
IGL02549:Ccdc88c APN 12 100928932 missense probably benign 0.18
IGL02618:Ccdc88c APN 12 100913553 missense probably benign 0.28
IGL02626:Ccdc88c APN 12 100967800 unclassified probably benign
IGL03142:Ccdc88c APN 12 100947198 missense probably damaging 1.00
BB010:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
BB020:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R0127:Ccdc88c UTSW 12 100935740 missense possibly damaging 0.88
R0533:Ccdc88c UTSW 12 100954282 missense probably damaging 1.00
R0545:Ccdc88c UTSW 12 100947188 missense probably damaging 1.00
R0866:Ccdc88c UTSW 12 100913192 missense probably benign 0.01
R1230:Ccdc88c UTSW 12 100948488 missense probably benign 0.00
R1434:Ccdc88c UTSW 12 100939166 splice site probably benign
R1614:Ccdc88c UTSW 12 100912984 missense probably benign 0.00
R1644:Ccdc88c UTSW 12 100913474 missense probably damaging 0.98
R1712:Ccdc88c UTSW 12 100939025 missense probably benign 0.14
R2107:Ccdc88c UTSW 12 100921549 missense probably benign
R3612:Ccdc88c UTSW 12 100939073 missense probably damaging 0.99
R3724:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3737:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3743:Ccdc88c UTSW 12 100948584 missense probably damaging 1.00
R3772:Ccdc88c UTSW 12 100966100 unclassified probably benign
R3776:Ccdc88c UTSW 12 100947179 missense probably damaging 0.97
R3917:Ccdc88c UTSW 12 100941107 critical splice donor site probably null
R4034:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4035:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4110:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4113:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4270:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4271:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4520:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4521:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4522:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4523:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4524:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4717:Ccdc88c UTSW 12 100916666 missense probably benign 0.00
R4821:Ccdc88c UTSW 12 100938079 missense probably benign 0.00
R4823:Ccdc88c UTSW 12 100930543 missense probably damaging 1.00
R5090:Ccdc88c UTSW 12 100954180 missense probably damaging 1.00
R5510:Ccdc88c UTSW 12 100945031 missense probably damaging 1.00
R5514:Ccdc88c UTSW 12 100913439 missense probably damaging 1.00
R5903:Ccdc88c UTSW 12 100930542 missense probably damaging 1.00
R5999:Ccdc88c UTSW 12 100968354 missense probably damaging 1.00
R6131:Ccdc88c UTSW 12 100941128 missense probably damaging 1.00
R6164:Ccdc88c UTSW 12 100953383 missense probably damaging 0.98
R6971:Ccdc88c UTSW 12 100954227 missense probably damaging 1.00
R6998:Ccdc88c UTSW 12 100916852 missense probably damaging 0.96
R7031:Ccdc88c UTSW 12 100945064 missense probably damaging 1.00
R7366:Ccdc88c UTSW 12 100944950 missense possibly damaging 0.89
R7604:Ccdc88c UTSW 12 100930547 missense probably damaging 1.00
R7674:Ccdc88c UTSW 12 100945232 missense probably benign 0.00
R7795:Ccdc88c UTSW 12 100923311 missense probably benign 0.32
R7933:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R7990:Ccdc88c UTSW 12 100967985 missense probably damaging 1.00
R8339:Ccdc88c UTSW 12 100941140 nonsense probably null
R8734:Ccdc88c UTSW 12 100940135 missense probably damaging 1.00
R8778:Ccdc88c UTSW 12 100945224 missense probably benign 0.25
R8925:Ccdc88c UTSW 12 100966417 missense possibly damaging 0.55
R8927:Ccdc88c UTSW 12 100966417 missense possibly damaging 0.55
R9014:Ccdc88c UTSW 12 100913064 missense probably benign 0.09
R9204:Ccdc88c UTSW 12 100938063 missense unknown
R9257:Ccdc88c UTSW 12 100923215 missense possibly damaging 0.94
R9326:Ccdc88c UTSW 12 101028850 start gained probably benign
R9424:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R9439:Ccdc88c UTSW 12 100918338 missense probably benign 0.25
R9539:Ccdc88c UTSW 12 100935734 missense possibly damaging 0.89
R9576:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
Z1176:Ccdc88c UTSW 12 100945770 missense possibly damaging 0.69
Z1177:Ccdc88c UTSW 12 100945155 missense probably benign
Z1190:Ccdc88c UTSW 12 100923332 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGGACACACCAAGATCTC -3'
(R):5'- TAGAGACTCTCCAGCTCACC -3'

Sequencing Primer
(F):5'- AGATCTCCCTGAACCTCCC -3'
(R):5'- ACCCACAAGCAGCTGGAGG -3'
Posted On 2019-06-26