Mutagenetix > Incidental Mutations

Incidental Mutation 'R7240:Notch4'

563166

Institutional Source

Beutler Lab

Gene Symbol

Notch4

Ensembl Gene

ENSMUSG00000015468

Gene Name

notch 4

Synonyms

Int3, N4, Int-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7240 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34564268-34588503 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34576471 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 792 (T792A)

Ref Sequence

ENSEMBL: ENSMUSP00000015612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]

Predicted Effect

probably benign
Transcript: ENSMUST00000015612
AA Change: T792A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: T792A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	24	60	3.2e-4	SMART
EGF	64	112	1.07e-5	SMART
EGF	118	152	5.49e-3	SMART
EGF	156	189	9.33e-6	SMART
EGF_CA	191	229	1.42e-10	SMART
EGF	234	271	1.11e-3	SMART
EGF	276	309	1.84e-4	SMART
EGF_CA	311	350	2.52e-11	SMART
EGF_CA	352	388	1.85e-9	SMART
EGF	392	427	1.58e-3	SMART
EGF_CA	429	470	2.46e-14	SMART
EGF_CA	472	508	5.03e-11	SMART
EGF_CA	510	546	6.74e-12	SMART
EGF_CA	548	584	2.98e-13	SMART
EGF_CA	586	622	7.63e-11	SMART
EGF_like	645	686	2.86e1	SMART
EGF	691	724	3.48e-5	SMART
EGF	729	762	3.62e-3	SMART
EGF_CA	764	800	1.48e-8	SMART
EGF	806	839	1.74e-5	SMART
EGF	844	877	2.3e-5	SMART
EGF	881	924	3.59e-7	SMART
EGF_CA	926	962	7.29e-8	SMART
EGF_CA	965	1000	4.42e-7	SMART
EGF_CA	1002	1040	4.56e-9	SMART
EGF	1045	1081	6.16e-6	SMART
EGF	1086	1122	8.65e-1	SMART
EGF	1129	1167	1.45e-2	SMART
NL	1159	1200	6.79e-13	SMART
NL	1203	1242	2.01e-15	SMART
NL	1243	1281	1.85e-14	SMART
NOD	1287	1341	4.37e-8	SMART
NODP	1373	1437	2.12e-6	SMART
transmembrane domain	1441	1463	N/A	INTRINSIC
low complexity region	1525	1539	N/A	INTRINSIC
ANK	1578	1623	2.5e3	SMART
ANK	1628	1657	1.12e-3	SMART
ANK	1661	1691	5.01e-1	SMART
ANK	1695	1724	1.65e-1	SMART
ANK	1728	1757	4.56e-4	SMART
ANK	1761	1790	2.88e-1	SMART
low complexity region	1889	1906	N/A	INTRINSIC
low complexity region	1925	1937	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173389
AA Change: T796A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468
AA Change: T796A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	28	64	3.2e-4	SMART
EGF	68	116	1.07e-5	SMART
EGF	122	156	5.49e-3	SMART
EGF	160	193	9.33e-6	SMART
EGF_CA	195	233	1.42e-10	SMART
EGF	238	275	1.11e-3	SMART
EGF	280	313	1.84e-4	SMART
EGF_CA	315	354	2.52e-11	SMART
EGF_CA	356	392	1.85e-9	SMART
EGF	396	431	1.58e-3	SMART
EGF_CA	433	474	2.46e-14	SMART
EGF_CA	476	512	5.03e-11	SMART
EGF_CA	514	550	6.74e-12	SMART
EGF_CA	552	588	2.98e-13	SMART
EGF_CA	590	626	7.63e-11	SMART
EGF_like	649	690	2.86e1	SMART
EGF	695	728	3.48e-5	SMART
EGF	733	766	3.62e-3	SMART
EGF_CA	768	804	1.48e-8	SMART
EGF	810	843	1.74e-5	SMART
EGF	848	881	2.3e-5	SMART
EGF	885	928	3.59e-7	SMART
EGF_like	930	955	7.02e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210017I01Rik	A	G	3: 92,605,075	I59T	unknown	Het
Aspm	C	T	1: 139,478,651	Q1759*	probably null	Het
Atn1	A	T	6: 124,747,898	I124K	unknown	Het
Catsper2	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT	2: 121,397,572		probably benign	Het
Ccdc88c	C	T	12: 100,944,939	V879M	probably benign	Het
Cd300c	A	G	11: 114,959,783	C65R	possibly damaging	Het
Cd69	A	T	6: 129,270,042	S112T	possibly damaging	Het
Cdh19	T	C	1: 110,893,407	T534A	probably benign	Het
Cdk5rap2	T	A	4: 70,291,908	D701V	probably damaging	Het
D130052B06Rik	A	G	11: 33,623,874	H157R	possibly damaging	Het
Dpf1	T	A	7: 29,311,627	F150L	probably benign	Het
Dsg1c	T	C	18: 20,283,109	L689P	probably damaging	Het
Dstyk	G	A	1: 132,454,123	M538I	probably benign	Het
E4f1	T	A	17: 24,444,325	I669F	probably damaging	Het
Gm7138	T	C	10: 77,776,755	T64A	unknown	Het
Gnai2	A	C	9: 107,615,773	D310E		Het
Iqca	A	G	1: 90,070,550	V567A	possibly damaging	Het
Iqgap1	A	T	7: 80,759,839	N249K	probably benign	Het
Lamc1	A	G	1: 153,234,650	V1093A	possibly damaging	Het
Mfap3	A	G	11: 57,529,756	K188E	probably damaging	Het
N4bp2	T	A	5: 65,794,545	V431D	probably damaging	Het
Ntn4	A	G	10: 93,745,741	H592R	probably damaging	Het
Ofcc1	A	G	13: 40,208,841	C202R	probably benign	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr418	T	C	1: 173,270,994	I273T	probably benign	Het
Olfr476	T	C	7: 107,968,188	S264P	probably benign	Het
Olfr497	A	G	7: 108,422,933	M121V	probably damaging	Het
Olfr922	A	G	9: 38,815,713	D70G	probably benign	Het
Olfr938	A	T	9: 39,078,610	M45K	probably damaging	Het
Parpbp	G	A	10: 88,124,940	T228I	probably damaging	Het
Pcdhgb8	G	A	18: 37,763,703	V609M	probably damaging	Het
Pla2g4d	T	C	2: 120,270,349	N543S	probably damaging	Het
Puf60	A	G	15: 76,072,539		probably benign	Het
Rbm6	A	T	9: 107,852,896	D184E	probably damaging	Het
Rnase9	A	C	14: 51,038,979	S181A	probably benign	Het
Rnpc3	T	A	3: 113,616,831	R270S	probably damaging	Het
Rundc1	T	C	11: 101,431,548		probably null	Het
Ryr1	T	C	7: 29,052,015	S3715G	possibly damaging	Het
Scn3a	A	T	2: 65,469,042	D1373E	possibly damaging	Het
Serpina3k	T	G	12: 104,340,602	I31S	probably benign	Het
Sipa1l2	A	G	8: 125,469,860	F712L	probably damaging	Het
Slc22a29	A	G	19: 8,161,511	V529A	probably damaging	Het
Tdrd3	A	G	14: 87,458,803	N58S	probably benign	Het
Tmc2	C	T	2: 130,234,804	T350I	possibly damaging	Het
Tpst2	T	C	5: 112,307,678	C28R	probably benign	Het
Trbv21	A	T	6: 41,202,958	K69N	probably benign	Het
Trpm2	A	G	10: 77,935,876		probably null	Het
Ttn	A	G	2: 76,848,990	V10796A	unknown	Het
Ush2a	A	G	1: 188,911,661	T4407A	possibly damaging	Het
Vmn2r95	A	G	17: 18,451,963	H726R	probably benign	Het
Zfp777	A	G	6: 48,044,449	S80P	probably benign	Het

Other mutations in Notch4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Notch4	APN	17	34575561	critical splice donor site	probably null
IGL01022:Notch4	APN	17	34565697	missense	probably damaging	1.00
IGL01356:Notch4	APN	17	34581026	missense	possibly damaging	0.67
IGL01634:Notch4	APN	17	34572588	missense	probably damaging	1.00
IGL02150:Notch4	APN	17	34584613	missense	probably damaging	1.00
IGL02248:Notch4	APN	17	34587198	missense	probably damaging	1.00
IGL02271:Notch4	APN	17	34568471	missense	probably damaging	1.00
IGL02299:Notch4	APN	17	34578004	missense	probably damaging	1.00
IGL02561:Notch4	APN	17	34568160	splice site	probably benign
IGL02604:Notch4	APN	17	34565388	splice site	probably null
IGL03323:Notch4	APN	17	34582471	missense	probably damaging	1.00
IGL03366:Notch4	APN	17	34572568	missense	probably damaging	1.00
IGL03408:Notch4	APN	17	34565568	missense	probably benign	0.03
K3955:Notch4	UTSW	17	34568462	missense	probably damaging	1.00
R0123:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0366:Notch4	UTSW	17	34581499	splice site	probably benign
R0446:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0490:Notch4	UTSW	17	34582890	missense	probably damaging	1.00
R0504:Notch4	UTSW	17	34575091	missense	probably damaging	1.00
R0545:Notch4	UTSW	17	34583433	missense	probably damaging	1.00
R0702:Notch4	UTSW	17	34575203	missense	probably damaging	1.00
R0763:Notch4	UTSW	17	34565332	nonsense	probably null
R0854:Notch4	UTSW	17	34568572	missense	probably damaging	1.00
R1082:Notch4	UTSW	17	34587390	missense	probably damaging	1.00
R1196:Notch4	UTSW	17	34568863	missense	probably damaging	1.00
R1316:Notch4	UTSW	17	34567470	missense	probably damaging	1.00
R1493:Notch4	UTSW	17	34567682	nonsense	probably null
R1527:Notch4	UTSW	17	34565744	missense	probably damaging	1.00
R1548:Notch4	UTSW	17	34568422	missense	probably damaging	1.00
R1718:Notch4	UTSW	17	34576763	splice site	probably benign
R1855:Notch4	UTSW	17	34580962	missense	probably benign	0.05
R1988:Notch4	UTSW	17	34587588	missense	possibly damaging	0.59
R2022:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2023:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2078:Notch4	UTSW	17	34568715	critical splice acceptor site	probably null
R2369:Notch4	UTSW	17	34585950	missense	probably benign	0.15
R3846:Notch4	UTSW	17	34578097	missense	probably damaging	1.00
R3874:Notch4	UTSW	17	34578069	nonsense	probably null
R4087:Notch4	UTSW	17	34584435	missense	probably damaging	1.00
R4456:Notch4	UTSW	17	34583833	missense	probably damaging	0.99
R4628:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R4728:Notch4	UTSW	17	34570205	missense	probably benign	0.00
R4778:Notch4	UTSW	17	34582511	missense	possibly damaging	0.95
R4818:Notch4	UTSW	17	34578716	splice site	probably benign
R4828:Notch4	UTSW	17	34570060	missense	probably damaging	1.00
R4830:Notch4	UTSW	17	34570118	missense	probably damaging	1.00
R4859:Notch4	UTSW	17	34587180	missense	probably damaging	1.00
R4871:Notch4	UTSW	17	34577562	missense	possibly damaging	0.63
R5090:Notch4	UTSW	17	34580920	missense	probably damaging	0.99
R5290:Notch4	UTSW	17	34565289	missense	probably benign	0.01
R5363:Notch4	UTSW	17	34587123	missense	probably damaging	1.00
R5860:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R6352:Notch4	UTSW	17	34567461	missense	probably damaging	1.00
R6385:Notch4	UTSW	17	34573814	missense	probably null	0.16
R6422:Notch4	UTSW	17	34584559	missense	probably benign
R6645:Notch4	UTSW	17	34587816	missense	probably benign	0.00
R6836:Notch4	UTSW	17	34586100	missense	probably damaging	0.96
R6943:Notch4	UTSW	17	34583603	missense	probably benign
R6991:Notch4	UTSW	17	34584800	nonsense	probably null
R7078:Notch4	UTSW	17	34582546	missense	possibly damaging	0.94
R7168:Notch4	UTSW	17	34572693	missense	probably benign	0.05
R7182:Notch4	UTSW	17	34583499	missense	probably damaging	1.00
R7247:Notch4	UTSW	17	34572517	missense	probably damaging	1.00
R7556:Notch4	UTSW	17	34575470	missense	probably damaging	1.00
R7571:Notch4	UTSW	17	34583574	missense	probably damaging	0.99
R7697:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R7763:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R7994:Notch4	UTSW	17	34578090	missense	possibly damaging	0.82
R8139:Notch4	UTSW	17	34584800	nonsense	probably null
R8171:Notch4	UTSW	17	34582509	nonsense	probably null
R8375:Notch4	UTSW	17	34568254	missense	possibly damaging	0.90
R8448:Notch4	UTSW	17	34586789	splice site	probably null
R8543:Notch4	UTSW	17	34568420	missense	probably damaging	1.00
X0054:Notch4	UTSW	17	34584495	missense	probably damaging	1.00
X0067:Notch4	UTSW	17	34586084	nonsense	probably null
Z1088:Notch4	UTSW	17	34587915	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34575148	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34587908	missense	probably damaging	0.97
Z1177:Notch4	UTSW	17	34587909	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGACATGTACAGAATCCTGCC -3'
(R):5'- GAAAGTCTGTTCTGGGAGACTG -3'

Sequencing Primer
(F):5'- CCTGCCATATAATATAAAGTTGT -3'
(R):5'- AGGCAACAGGTGTGGTTG -3'

Posted On

2019-06-26