Incidental Mutation 'R7240:Dsg1c'
ID563167
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7240 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20283109 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 689 (L689P)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: L689P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: L689P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,075 I59T unknown Het
Aspm C T 1: 139,478,651 Q1759* probably null Het
Atn1 A T 6: 124,747,898 I124K unknown Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc88c C T 12: 100,944,939 V879M probably benign Het
Cd300c A G 11: 114,959,783 C65R possibly damaging Het
Cd69 A T 6: 129,270,042 S112T possibly damaging Het
Cdh19 T C 1: 110,893,407 T534A probably benign Het
Cdk5rap2 T A 4: 70,291,908 D701V probably damaging Het
D130052B06Rik A G 11: 33,623,874 H157R possibly damaging Het
Dpf1 T A 7: 29,311,627 F150L probably benign Het
Dstyk G A 1: 132,454,123 M538I probably benign Het
E4f1 T A 17: 24,444,325 I669F probably damaging Het
Gm7138 T C 10: 77,776,755 T64A unknown Het
Gnai2 A C 9: 107,615,773 D310E Het
Iqca A G 1: 90,070,550 V567A possibly damaging Het
Iqgap1 A T 7: 80,759,839 N249K probably benign Het
Lamc1 A G 1: 153,234,650 V1093A possibly damaging Het
Mfap3 A G 11: 57,529,756 K188E probably damaging Het
N4bp2 T A 5: 65,794,545 V431D probably damaging Het
Notch4 A G 17: 34,576,471 T792A probably benign Het
Ntn4 A G 10: 93,745,741 H592R probably damaging Het
Ofcc1 A G 13: 40,208,841 C202R probably benign Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr418 T C 1: 173,270,994 I273T probably benign Het
Olfr476 T C 7: 107,968,188 S264P probably benign Het
Olfr497 A G 7: 108,422,933 M121V probably damaging Het
Olfr922 A G 9: 38,815,713 D70G probably benign Het
Olfr938 A T 9: 39,078,610 M45K probably damaging Het
Parpbp G A 10: 88,124,940 T228I probably damaging Het
Pcdhgb8 G A 18: 37,763,703 V609M probably damaging Het
Pla2g4d T C 2: 120,270,349 N543S probably damaging Het
Puf60 A G 15: 76,072,539 probably benign Het
Rbm6 A T 9: 107,852,896 D184E probably damaging Het
Rnase9 A C 14: 51,038,979 S181A probably benign Het
Rnpc3 T A 3: 113,616,831 R270S probably damaging Het
Rundc1 T C 11: 101,431,548 probably null Het
Ryr1 T C 7: 29,052,015 S3715G possibly damaging Het
Scn3a A T 2: 65,469,042 D1373E possibly damaging Het
Serpina3k T G 12: 104,340,602 I31S probably benign Het
Sipa1l2 A G 8: 125,469,860 F712L probably damaging Het
Slc22a29 A G 19: 8,161,511 V529A probably damaging Het
Tdrd3 A G 14: 87,458,803 N58S probably benign Het
Tmc2 C T 2: 130,234,804 T350I possibly damaging Het
Tpst2 T C 5: 112,307,678 C28R probably benign Het
Trbv21 A T 6: 41,202,958 K69N probably benign Het
Trpm2 A G 10: 77,935,876 probably null Het
Ttn A G 2: 76,848,990 V10796A unknown Het
Ush2a A G 1: 188,911,661 T4407A possibly damaging Het
Vmn2r95 A G 17: 18,451,963 H726R probably benign Het
Zfp777 A G 6: 48,044,449 S80P probably benign Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTCATGTGTGGATTATTGTC -3'
(R):5'- GGCAAATTGGTTCAGTGCTC -3'

Sequencing Primer
(F):5'- GTGTTCAAAGTGCACTATTTTAAGC -3'
(R):5'- TGCTCTGAGGAGGCCAAG -3'
Posted On2019-06-26