Incidental Mutation 'R7241:Ganc'
ID563178
Institutional Source Beutler Lab
Gene Symbol Ganc
Ensembl Gene ENSMUSG00000062646
Gene Nameglucosidase, alpha; neutral C
Synonyms5830445O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.673) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120403896-120461700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120441529 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 556 (I556K)
Ref Sequence ENSEMBL: ENSMUSP00000116898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135074]
Predicted Effect probably damaging
Transcript: ENSMUST00000135074
AA Change: I556K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: I556K

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Cyth4 A G 15: 78,607,045 K108R probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Flvcr2 T A 12: 85,805,239 D522E probably benign Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ift88 A G 14: 57,479,997 I559M probably damaging Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Lrriq1 A C 10: 103,215,973 V306G probably damaging Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkcz A T 4: 155,269,059 M460K probably benign Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Unc5a A T 13: 54,991,020 T71S probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Washc2 A G 6: 116,208,207 M1V probably null Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Ganc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ganc APN 2 120441598 missense probably damaging 1.00
IGL00913:Ganc APN 2 120439452 splice site probably benign
IGL01077:Ganc APN 2 120446515 missense possibly damaging 0.50
IGL01773:Ganc APN 2 120459884 missense possibly damaging 0.87
IGL01812:Ganc APN 2 120411526 missense probably benign 0.00
IGL02029:Ganc APN 2 120459857 missense probably benign 0.00
IGL02067:Ganc APN 2 120406304 missense probably benign 0.16
IGL02290:Ganc APN 2 120448423 missense possibly damaging 0.90
IGL02355:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02362:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02553:Ganc APN 2 120458134 missense probably benign
IGL02808:Ganc APN 2 120411511 missense probably benign 0.00
IGL02966:Ganc APN 2 120433648 missense probably damaging 1.00
IGL03356:Ganc APN 2 120435288 missense probably benign 0.22
IGL03405:Ganc APN 2 120433766 missense probably damaging 1.00
ingenuous UTSW 2 120444149 missense probably damaging 1.00
R0464:Ganc UTSW 2 120436694 missense probably benign 0.07
R0511:Ganc UTSW 2 120448401 nonsense probably null
R0932:Ganc UTSW 2 120458129 missense probably damaging 0.99
R1467:Ganc UTSW 2 120430928 splice site probably benign
R1902:Ganc UTSW 2 120446482 missense probably damaging 1.00
R2087:Ganc UTSW 2 120457257 missense probably damaging 1.00
R4668:Ganc UTSW 2 120431067 missense probably benign 0.02
R4669:Ganc UTSW 2 120431067 missense probably benign 0.02
R4725:Ganc UTSW 2 120435273 missense probably damaging 0.99
R4735:Ganc UTSW 2 120436623 splice site silent
R4738:Ganc UTSW 2 120452594 missense probably damaging 0.97
R4839:Ganc UTSW 2 120459823 missense probably benign
R4951:Ganc UTSW 2 120456047 missense probably benign 0.00
R5841:Ganc UTSW 2 120411539 missense possibly damaging 0.65
R5997:Ganc UTSW 2 120430605 missense possibly damaging 0.55
R6142:Ganc UTSW 2 120430737 critical splice donor site probably null
R6378:Ganc UTSW 2 120433826 missense probably damaging 1.00
R6711:Ganc UTSW 2 120450839 missense possibly damaging 0.74
R6777:Ganc UTSW 2 120444149 missense probably damaging 1.00
R7229:Ganc UTSW 2 120427775 missense possibly damaging 0.92
R7235:Ganc UTSW 2 120433717 missense probably damaging 1.00
R7326:Ganc UTSW 2 120430599 missense probably damaging 1.00
R7567:Ganc UTSW 2 120456101 missense probably benign 0.01
R7685:Ganc UTSW 2 120433792 missense probably damaging 1.00
R7736:Ganc UTSW 2 120433814 missense possibly damaging 0.83
R7784:Ganc UTSW 2 120436668 nonsense probably null
R7955:Ganc UTSW 2 120430700 missense probably damaging 1.00
R8222:Ganc UTSW 2 120446452 missense probably damaging 1.00
R8247:Ganc UTSW 2 120436700 missense probably null 0.52
R8306:Ganc UTSW 2 120422079 missense probably benign 0.02
X0027:Ganc UTSW 2 120448450 missense probably damaging 1.00
Z1177:Ganc UTSW 2 120433794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTAGCCACTCTTCTCATCTG -3'
(R):5'- GACTATTGAAGAGGAACATAGTGTC -3'

Sequencing Primer
(F):5'- CCATCTTCACCAGGTAAATTAATGTC -3'
(R):5'- TTGAAGAGGAACATAGTGTCAGCATG -3'
Posted On2019-06-26