Incidental Mutation 'R7241:Ganc'
ID 563178
Institutional Source Beutler Lab
Gene Symbol Ganc
Ensembl Gene ENSMUSG00000062646
Gene Name glucosidase, alpha; neutral C
Synonyms 5830445O15Rik
MMRRC Submission 045348-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.752) question?
Stock # R7241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120234377-120291347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120272010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 556 (I556K)
Ref Sequence ENSEMBL: ENSMUSP00000116898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135074]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000135074
AA Change: I556K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: I556K

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,846,184 (GRCm39) T612A probably damaging Het
Acacb G A 5: 114,383,161 (GRCm39) A2115T possibly damaging Het
Adam32 T C 8: 25,388,510 (GRCm39) K398R probably benign Het
Adam9 T A 8: 25,441,002 (GRCm39) I824F possibly damaging Het
Ahnak A G 19: 8,986,395 (GRCm39) I2560V possibly damaging Het
Ank3 G A 10: 69,542,644 (GRCm39) M1I probably null Het
Anks1b T G 10: 90,348,699 (GRCm39) I789S probably damaging Het
Ap2b1 T A 11: 83,241,931 (GRCm39) N641K probably benign Het
Arhgap33 A G 7: 30,228,146 (GRCm39) L412P probably damaging Het
Atp13a3 T A 16: 30,171,095 (GRCm39) M317L possibly damaging Het
B4galt5 A G 2: 167,148,617 (GRCm39) L167P probably damaging Het
Bace2 T C 16: 97,237,998 (GRCm39) I483T possibly damaging Het
C2cd3 A C 7: 100,056,257 (GRCm39) K177T Het
Ccr4 T C 9: 114,322,024 (GRCm39) T14A probably benign Het
Cep250 A T 2: 155,833,472 (GRCm39) H1799L probably benign Het
Cgnl1 T C 9: 71,632,052 (GRCm39) Q433R probably benign Het
Copb1 C T 7: 113,836,591 (GRCm39) V384M probably damaging Het
Cyp2c50 T A 19: 40,079,012 (GRCm39) N118K probably benign Het
Cyp4a32 A G 4: 115,459,499 (GRCm39) I78V probably benign Het
Cyth4 A G 15: 78,491,245 (GRCm39) K108R probably benign Het
Dnah1 T C 14: 30,986,896 (GRCm39) H3632R probably benign Het
Dnah3 T C 7: 119,542,856 (GRCm39) I540V probably benign Het
Dock4 A G 12: 40,844,859 (GRCm39) Y1174C probably damaging Het
Drd5 A G 5: 38,477,879 (GRCm39) T291A probably damaging Het
Eeig1 A G 2: 32,448,076 (GRCm39) R62G probably benign Het
Fbn1 T C 2: 125,148,415 (GRCm39) N2611S possibly damaging Het
Fcsk A G 8: 111,622,529 (GRCm39) I133T probably benign Het
Fhod3 A G 18: 25,193,409 (GRCm39) E640G probably damaging Het
Flvcr2 T A 12: 85,852,013 (GRCm39) D522E probably benign Het
Gjc2 T A 11: 59,067,960 (GRCm39) E174V unknown Het
Gzmd G A 14: 56,368,799 (GRCm39) R32C probably damaging Het
Hltf T A 3: 20,119,556 (GRCm39) H200Q probably benign Het
Ift88 A G 14: 57,717,454 (GRCm39) I559M probably damaging Het
Ighv1-62-1 C A 12: 115,350,322 (GRCm39) C115F probably damaging Het
Impdh2 A G 9: 108,440,636 (GRCm39) N279S possibly damaging Het
Itpr1 T C 6: 108,494,581 (GRCm39) probably null Het
Kansl1l T C 1: 66,840,787 (GRCm39) N171S possibly damaging Het
Kif14 T A 1: 136,396,491 (GRCm39) C266S probably benign Het
Kif19b A G 5: 140,447,943 (GRCm39) T137A probably damaging Het
Lrriq1 A C 10: 103,051,834 (GRCm39) V306G probably damaging Het
Mast4 G A 13: 103,470,508 (GRCm39) R65W possibly damaging Het
Mex3d T C 10: 80,223,091 (GRCm39) D55G Het
Mrps27 A T 13: 99,547,788 (GRCm39) K233* probably null Het
Myo1f A G 17: 33,798,902 (GRCm39) N189S probably damaging Het
Nbn A T 4: 15,991,190 (GRCm39) K729N probably benign Het
Or1e35 T C 11: 73,798,058 (GRCm39) S87G probably benign Het
Or8k35 C A 2: 86,424,498 (GRCm39) V225F possibly damaging Het
Pgghg T C 7: 140,525,633 (GRCm39) S479P Het
Plaat5 A G 19: 7,591,946 (GRCm39) T121A probably benign Het
Polr1e A C 4: 45,029,340 (GRCm39) H315P probably damaging Het
Pou6f2 A G 13: 18,299,874 (GRCm39) V595A Het
Prdm15 T C 16: 97,596,941 (GRCm39) D960G possibly damaging Het
Prkcz A T 4: 155,353,516 (GRCm39) M460K probably benign Het
Prkd2 G T 7: 16,591,730 (GRCm39) R587L probably benign Het
Prkn C A 17: 12,073,748 (GRCm39) N355K possibly damaging Het
Rabep1 C A 11: 70,830,815 (GRCm39) T829N probably damaging Het
Rptn A G 3: 93,303,261 (GRCm39) E198G probably benign Het
Ryr2 A T 13: 11,680,799 (GRCm39) I3182N possibly damaging Het
Sectm1a T A 11: 120,960,708 (GRCm39) I36F possibly damaging Het
Sez6l T C 5: 112,621,346 (GRCm39) S243G probably benign Het
Spata31h1 T C 10: 82,122,876 (GRCm39) E3378G probably benign Het
Taf2 T A 15: 54,925,537 (GRCm39) H235L probably benign Het
Tbc1d7 T C 13: 43,306,493 (GRCm39) Q161R probably benign Het
Tfcp2 T C 15: 100,416,468 (GRCm39) T271A possibly damaging Het
Thrsp G T 7: 97,066,295 (GRCm39) T139K probably damaging Het
Timm10 T A 2: 84,660,333 (GRCm39) *91R probably null Het
Tlr11 T A 14: 50,599,598 (GRCm39) I528N possibly damaging Het
Tnnt2 T A 1: 135,779,444 (GRCm39) L278Q probably damaging Het
Toe1 A T 4: 116,664,715 (GRCm39) M1K probably null Het
Trpv5 G A 6: 41,652,242 (GRCm39) R148* probably null Het
Ttll13 A C 7: 79,903,911 (GRCm39) K280Q probably damaging Het
Ttn A G 2: 76,783,550 (GRCm39) V860A unknown Het
Txnip T C 3: 96,466,991 (GRCm39) Y222H probably damaging Het
Ubr4 G A 4: 139,170,725 (GRCm39) S1600N probably damaging Het
Uhrf1 T C 17: 56,622,193 (GRCm39) Y364H probably damaging Het
Unc5a A T 13: 55,138,833 (GRCm39) T71S probably damaging Het
Vmn1r123 A T 7: 20,896,537 (GRCm39) Y143F possibly damaging Het
Vmn1r180 T A 7: 23,651,891 (GRCm39) I18N probably damaging Het
Washc2 A G 6: 116,185,168 (GRCm39) M1V probably null Het
Zfp174 C A 16: 3,666,111 (GRCm39) H125Q probably benign Het
Zfpl1 T C 19: 6,131,943 (GRCm39) H227R possibly damaging Het
Other mutations in Ganc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ganc APN 2 120,272,079 (GRCm39) missense probably damaging 1.00
IGL00913:Ganc APN 2 120,269,933 (GRCm39) splice site probably benign
IGL01077:Ganc APN 2 120,276,996 (GRCm39) missense possibly damaging 0.50
IGL01773:Ganc APN 2 120,290,365 (GRCm39) missense possibly damaging 0.87
IGL01812:Ganc APN 2 120,242,007 (GRCm39) missense probably benign 0.00
IGL02029:Ganc APN 2 120,290,338 (GRCm39) missense probably benign 0.00
IGL02067:Ganc APN 2 120,236,785 (GRCm39) missense probably benign 0.16
IGL02290:Ganc APN 2 120,278,904 (GRCm39) missense possibly damaging 0.90
IGL02355:Ganc APN 2 120,264,238 (GRCm39) missense probably damaging 1.00
IGL02362:Ganc APN 2 120,264,238 (GRCm39) missense probably damaging 1.00
IGL02553:Ganc APN 2 120,288,615 (GRCm39) missense probably benign
IGL02808:Ganc APN 2 120,241,992 (GRCm39) missense probably benign 0.00
IGL02966:Ganc APN 2 120,264,129 (GRCm39) missense probably damaging 1.00
IGL03356:Ganc APN 2 120,265,769 (GRCm39) missense probably benign 0.22
IGL03405:Ganc APN 2 120,264,247 (GRCm39) missense probably damaging 1.00
ingenuous UTSW 2 120,274,630 (GRCm39) missense probably damaging 1.00
R0464:Ganc UTSW 2 120,267,175 (GRCm39) missense probably benign 0.07
R0511:Ganc UTSW 2 120,278,882 (GRCm39) nonsense probably null
R0932:Ganc UTSW 2 120,288,610 (GRCm39) missense probably damaging 0.99
R1467:Ganc UTSW 2 120,261,409 (GRCm39) splice site probably benign
R1902:Ganc UTSW 2 120,276,963 (GRCm39) missense probably damaging 1.00
R2087:Ganc UTSW 2 120,287,738 (GRCm39) missense probably damaging 1.00
R4668:Ganc UTSW 2 120,261,548 (GRCm39) missense probably benign 0.02
R4669:Ganc UTSW 2 120,261,548 (GRCm39) missense probably benign 0.02
R4725:Ganc UTSW 2 120,265,754 (GRCm39) missense probably damaging 0.99
R4735:Ganc UTSW 2 120,267,104 (GRCm39) splice site silent
R4738:Ganc UTSW 2 120,283,075 (GRCm39) missense probably damaging 0.97
R4839:Ganc UTSW 2 120,290,304 (GRCm39) missense probably benign
R4951:Ganc UTSW 2 120,286,528 (GRCm39) missense probably benign 0.00
R5841:Ganc UTSW 2 120,242,020 (GRCm39) missense possibly damaging 0.65
R5997:Ganc UTSW 2 120,261,086 (GRCm39) missense possibly damaging 0.55
R6142:Ganc UTSW 2 120,261,218 (GRCm39) critical splice donor site probably null
R6378:Ganc UTSW 2 120,264,307 (GRCm39) missense probably damaging 1.00
R6711:Ganc UTSW 2 120,281,320 (GRCm39) missense possibly damaging 0.74
R6777:Ganc UTSW 2 120,274,630 (GRCm39) missense probably damaging 1.00
R7229:Ganc UTSW 2 120,258,256 (GRCm39) missense possibly damaging 0.92
R7235:Ganc UTSW 2 120,264,198 (GRCm39) missense probably damaging 1.00
R7326:Ganc UTSW 2 120,261,080 (GRCm39) missense probably damaging 1.00
R7567:Ganc UTSW 2 120,286,582 (GRCm39) missense probably benign 0.01
R7685:Ganc UTSW 2 120,264,273 (GRCm39) missense probably damaging 1.00
R7736:Ganc UTSW 2 120,264,295 (GRCm39) missense possibly damaging 0.83
R7784:Ganc UTSW 2 120,267,149 (GRCm39) nonsense probably null
R7955:Ganc UTSW 2 120,261,181 (GRCm39) missense probably damaging 1.00
R8222:Ganc UTSW 2 120,276,933 (GRCm39) missense probably damaging 1.00
R8247:Ganc UTSW 2 120,267,181 (GRCm39) missense probably null 0.52
R8306:Ganc UTSW 2 120,252,560 (GRCm39) missense probably benign 0.02
R9282:Ganc UTSW 2 120,290,381 (GRCm39) missense probably benign
X0027:Ganc UTSW 2 120,278,931 (GRCm39) missense probably damaging 1.00
Z1177:Ganc UTSW 2 120,264,275 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTAGCCACTCTTCTCATCTG -3'
(R):5'- GACTATTGAAGAGGAACATAGTGTC -3'

Sequencing Primer
(F):5'- CCATCTTCACCAGGTAAATTAATGTC -3'
(R):5'- TTGAAGAGGAACATAGTGTCAGCATG -3'
Posted On 2019-06-26