Incidental Mutation 'R7241:Txnip'
ID 563184
Institutional Source Beutler Lab
Gene Symbol Txnip
Ensembl Gene ENSMUSG00000038393
Gene Name thioredoxin interacting protein
Synonyms mVDUP1, VDUP1, Hyplip1, THIF
MMRRC Submission 045348-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 96465273-96469173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96466991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 222 (Y222H)
Ref Sequence ENSEMBL: ENSMUSP00000102710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049093] [ENSMUST00000074519]
AlphaFold Q8BG60
Predicted Effect probably damaging
Transcript: ENSMUST00000049093
AA Change: Y221H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041467
Gene: ENSMUSG00000038393
AA Change: Y221H

DomainStartEndE-ValueType
Pfam:Arrestin_N 10 152 6.8e-26 PFAM
Arrestin_C 174 301 6.4e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074519
AA Change: Y222H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102710
Gene: ENSMUSG00000038393
AA Change: Y222H

DomainStartEndE-ValueType
Pfam:Arrestin_N 10 153 1.1e-25 PFAM
Arrestin_C 175 302 6.4e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display impaired natural killer cell development and activity, hyperplasia of lymphoid tissue in the ileum, and increased T cell proliferation. Lipid metabolism and blood clotting were also affected by another null mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,846,184 (GRCm39) T612A probably damaging Het
Acacb G A 5: 114,383,161 (GRCm39) A2115T possibly damaging Het
Adam32 T C 8: 25,388,510 (GRCm39) K398R probably benign Het
Adam9 T A 8: 25,441,002 (GRCm39) I824F possibly damaging Het
Ahnak A G 19: 8,986,395 (GRCm39) I2560V possibly damaging Het
Ank3 G A 10: 69,542,644 (GRCm39) M1I probably null Het
Anks1b T G 10: 90,348,699 (GRCm39) I789S probably damaging Het
Ap2b1 T A 11: 83,241,931 (GRCm39) N641K probably benign Het
Arhgap33 A G 7: 30,228,146 (GRCm39) L412P probably damaging Het
Atp13a3 T A 16: 30,171,095 (GRCm39) M317L possibly damaging Het
B4galt5 A G 2: 167,148,617 (GRCm39) L167P probably damaging Het
Bace2 T C 16: 97,237,998 (GRCm39) I483T possibly damaging Het
C2cd3 A C 7: 100,056,257 (GRCm39) K177T Het
Ccr4 T C 9: 114,322,024 (GRCm39) T14A probably benign Het
Cep250 A T 2: 155,833,472 (GRCm39) H1799L probably benign Het
Cgnl1 T C 9: 71,632,052 (GRCm39) Q433R probably benign Het
Copb1 C T 7: 113,836,591 (GRCm39) V384M probably damaging Het
Cyp2c50 T A 19: 40,079,012 (GRCm39) N118K probably benign Het
Cyp4a32 A G 4: 115,459,499 (GRCm39) I78V probably benign Het
Cyth4 A G 15: 78,491,245 (GRCm39) K108R probably benign Het
Dnah1 T C 14: 30,986,896 (GRCm39) H3632R probably benign Het
Dnah3 T C 7: 119,542,856 (GRCm39) I540V probably benign Het
Dock4 A G 12: 40,844,859 (GRCm39) Y1174C probably damaging Het
Drd5 A G 5: 38,477,879 (GRCm39) T291A probably damaging Het
Eeig1 A G 2: 32,448,076 (GRCm39) R62G probably benign Het
Fbn1 T C 2: 125,148,415 (GRCm39) N2611S possibly damaging Het
Fcsk A G 8: 111,622,529 (GRCm39) I133T probably benign Het
Fhod3 A G 18: 25,193,409 (GRCm39) E640G probably damaging Het
Flvcr2 T A 12: 85,852,013 (GRCm39) D522E probably benign Het
Ganc T A 2: 120,272,010 (GRCm39) I556K probably damaging Het
Gjc2 T A 11: 59,067,960 (GRCm39) E174V unknown Het
Gzmd G A 14: 56,368,799 (GRCm39) R32C probably damaging Het
Hltf T A 3: 20,119,556 (GRCm39) H200Q probably benign Het
Ift88 A G 14: 57,717,454 (GRCm39) I559M probably damaging Het
Ighv1-62-1 C A 12: 115,350,322 (GRCm39) C115F probably damaging Het
Impdh2 A G 9: 108,440,636 (GRCm39) N279S possibly damaging Het
Itpr1 T C 6: 108,494,581 (GRCm39) probably null Het
Kansl1l T C 1: 66,840,787 (GRCm39) N171S possibly damaging Het
Kif14 T A 1: 136,396,491 (GRCm39) C266S probably benign Het
Kif19b A G 5: 140,447,943 (GRCm39) T137A probably damaging Het
Lrriq1 A C 10: 103,051,834 (GRCm39) V306G probably damaging Het
Mast4 G A 13: 103,470,508 (GRCm39) R65W possibly damaging Het
Mex3d T C 10: 80,223,091 (GRCm39) D55G Het
Mrps27 A T 13: 99,547,788 (GRCm39) K233* probably null Het
Myo1f A G 17: 33,798,902 (GRCm39) N189S probably damaging Het
Nbn A T 4: 15,991,190 (GRCm39) K729N probably benign Het
Or1e35 T C 11: 73,798,058 (GRCm39) S87G probably benign Het
Or8k35 C A 2: 86,424,498 (GRCm39) V225F possibly damaging Het
Pgghg T C 7: 140,525,633 (GRCm39) S479P Het
Plaat5 A G 19: 7,591,946 (GRCm39) T121A probably benign Het
Polr1e A C 4: 45,029,340 (GRCm39) H315P probably damaging Het
Pou6f2 A G 13: 18,299,874 (GRCm39) V595A Het
Prdm15 T C 16: 97,596,941 (GRCm39) D960G possibly damaging Het
Prkcz A T 4: 155,353,516 (GRCm39) M460K probably benign Het
Prkd2 G T 7: 16,591,730 (GRCm39) R587L probably benign Het
Prkn C A 17: 12,073,748 (GRCm39) N355K possibly damaging Het
Rabep1 C A 11: 70,830,815 (GRCm39) T829N probably damaging Het
Rptn A G 3: 93,303,261 (GRCm39) E198G probably benign Het
Ryr2 A T 13: 11,680,799 (GRCm39) I3182N possibly damaging Het
Sectm1a T A 11: 120,960,708 (GRCm39) I36F possibly damaging Het
Sez6l T C 5: 112,621,346 (GRCm39) S243G probably benign Het
Spata31h1 T C 10: 82,122,876 (GRCm39) E3378G probably benign Het
Taf2 T A 15: 54,925,537 (GRCm39) H235L probably benign Het
Tbc1d7 T C 13: 43,306,493 (GRCm39) Q161R probably benign Het
Tfcp2 T C 15: 100,416,468 (GRCm39) T271A possibly damaging Het
Thrsp G T 7: 97,066,295 (GRCm39) T139K probably damaging Het
Timm10 T A 2: 84,660,333 (GRCm39) *91R probably null Het
Tlr11 T A 14: 50,599,598 (GRCm39) I528N possibly damaging Het
Tnnt2 T A 1: 135,779,444 (GRCm39) L278Q probably damaging Het
Toe1 A T 4: 116,664,715 (GRCm39) M1K probably null Het
Trpv5 G A 6: 41,652,242 (GRCm39) R148* probably null Het
Ttll13 A C 7: 79,903,911 (GRCm39) K280Q probably damaging Het
Ttn A G 2: 76,783,550 (GRCm39) V860A unknown Het
Ubr4 G A 4: 139,170,725 (GRCm39) S1600N probably damaging Het
Uhrf1 T C 17: 56,622,193 (GRCm39) Y364H probably damaging Het
Unc5a A T 13: 55,138,833 (GRCm39) T71S probably damaging Het
Vmn1r123 A T 7: 20,896,537 (GRCm39) Y143F possibly damaging Het
Vmn1r180 T A 7: 23,651,891 (GRCm39) I18N probably damaging Het
Washc2 A G 6: 116,185,168 (GRCm39) M1V probably null Het
Zfp174 C A 16: 3,666,111 (GRCm39) H125Q probably benign Het
Zfpl1 T C 19: 6,131,943 (GRCm39) H227R possibly damaging Het
Other mutations in Txnip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Txnip APN 3 96,465,673 (GRCm39) missense probably damaging 1.00
IGL02953:Txnip APN 3 96,465,682 (GRCm39) missense probably damaging 0.97
IGL03066:Txnip APN 3 96,466,934 (GRCm39) missense probably damaging 0.97
P0029:Txnip UTSW 3 96,467,679 (GRCm39) splice site probably null
R0336:Txnip UTSW 3 96,467,295 (GRCm39) missense probably benign 0.00
R1604:Txnip UTSW 3 96,466,277 (GRCm39) missense probably benign 0.18
R1988:Txnip UTSW 3 96,467,066 (GRCm39) missense possibly damaging 0.50
R4603:Txnip UTSW 3 96,465,604 (GRCm39) missense probably benign
R4659:Txnip UTSW 3 96,466,743 (GRCm39) missense probably damaging 1.00
R4845:Txnip UTSW 3 96,466,916 (GRCm39) missense probably benign 0.36
R6787:Txnip UTSW 3 96,467,623 (GRCm39) missense probably damaging 1.00
R6992:Txnip UTSW 3 96,466,439 (GRCm39) missense possibly damaging 0.47
R7488:Txnip UTSW 3 96,467,539 (GRCm39) missense probably benign 0.05
R7663:Txnip UTSW 3 96,467,153 (GRCm39) missense possibly damaging 0.82
R8151:Txnip UTSW 3 96,466,929 (GRCm39) missense possibly damaging 0.94
R8669:Txnip UTSW 3 96,466,252 (GRCm39) missense probably damaging 1.00
R9582:Txnip UTSW 3 96,465,659 (GRCm39) nonsense probably null
X0050:Txnip UTSW 3 96,467,094 (GRCm39) missense probably damaging 1.00
X0057:Txnip UTSW 3 96,466,281 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGCTTCAAATGCTAGACAGG -3'
(R):5'- CAGCAAGGAGTATTCGACTTTGAG -3'

Sequencing Primer
(F):5'- CTGCTTCAAATGCTAGACAGGATAGC -3'
(R):5'- ACTTTGAGGATGTTGCAGCCC -3'
Posted On 2019-06-26