Incidental Mutation 'R7241:Prkcz'
ID563190
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155269059 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 460 (M460K)
Ref Sequence ENSEMBL: ENSMUSP00000030922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178]
Predicted Effect probably benign
Transcript: ENSMUST00000030922
AA Change: M460K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: M460K

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103178
AA Change: M277K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: M277K

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Cyth4 A G 15: 78,607,045 K108R probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Flvcr2 T A 12: 85,805,239 D522E probably benign Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Ganc T A 2: 120,441,529 I556K probably damaging Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ift88 A G 14: 57,479,997 I559M probably damaging Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Lrriq1 A C 10: 103,215,973 V306G probably damaging Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Unc5a A T 13: 54,991,020 T71S probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Washc2 A G 6: 116,208,207 M1V probably null Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7618:Prkcz UTSW 4 155262482 missense probably damaging 1.00
R7753:Prkcz UTSW 4 155272968 missense possibly damaging 0.61
R8079:Prkcz UTSW 4 155357505 missense probably damaging 1.00
R8407:Prkcz UTSW 4 155268216 missense probably damaging 0.99
R8523:Prkcz UTSW 4 155262511 missense probably damaging 1.00
R8824:Prkcz UTSW 4 155344828 start gained probably benign
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGTTTTACAATCTCTGCCAGAG -3'
(R):5'- AGCGACTCTCTTGGCACATTC -3'

Sequencing Primer
(F):5'- TTTACAATCTCTGCCAGAGGAATGGG -3'
(R):5'- TTGGCACATTCACACTCACGG -3'
Posted On2019-06-26