Mutagenetix > Incidental Mutation

Incidental Mutation 'R7241:Acacb'

563193

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7241 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114245100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 2115 (A2115T)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: A2115T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: A2115T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: A2115T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: A2115T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,287,042	E3378G	probably benign	Het
Abca14	A	G	7: 120,246,961	T612A	probably damaging	Het
Adam32	T	C	8: 24,898,494	K398R	probably benign	Het
Adam9	T	A	8: 24,950,986	I824F	possibly damaging	Het
Ahnak	A	G	19: 9,009,031	I2560V	possibly damaging	Het
Ank3	G	A	10: 69,706,814	M1I	probably null	Het
Anks1b	T	G	10: 90,512,837	I789S	probably damaging	Het
Ap2b1	T	A	11: 83,351,105	N641K	probably benign	Het
Arhgap33	A	G	7: 30,528,721	L412P	probably damaging	Het
Atp13a3	T	A	16: 30,352,277	M317L	possibly damaging	Het
B4galt5	A	G	2: 167,306,697	L167P	probably damaging	Het
Bace2	T	C	16: 97,436,798	I483T	possibly damaging	Het
C2cd3	A	C	7: 100,407,050	K177T		Het
Ccr4	T	C	9: 114,492,956	T14A	probably benign	Het
Cep250	A	T	2: 155,991,552	H1799L	probably benign	Het
Cgnl1	T	C	9: 71,724,770	Q433R	probably benign	Het
Copb1	C	T	7: 114,237,356	V384M	probably damaging	Het
Cyp2c50	T	A	19: 40,090,568	N118K	probably benign	Het
Cyp4a32	A	G	4: 115,602,302	I78V	probably benign	Het
Cyth4	A	G	15: 78,607,045	K108R	probably benign	Het
Dnah1	T	C	14: 31,264,939	H3632R	probably benign	Het
Dnah3	T	C	7: 119,943,633	I540V	probably benign	Het
Dock4	A	G	12: 40,794,860	Y1174C	probably damaging	Het
Drd5	A	G	5: 38,320,536	T291A	probably damaging	Het
Fam102a	A	G	2: 32,558,064	R62G	probably benign	Het
Fbn1	T	C	2: 125,306,495	N2611S	possibly damaging	Het
Fhod3	A	G	18: 25,060,352	E640G	probably damaging	Het
Flvcr2	T	A	12: 85,805,239	D522E	probably benign	Het
Fuk	A	G	8: 110,895,897	I133T	probably benign	Het
Ganc	T	A	2: 120,441,529	I556K	probably damaging	Het
Gjc2	T	A	11: 59,177,134	E174V	unknown	Het
Gm4869	A	G	5: 140,462,188	T137A	probably damaging	Het
Gzmd	G	A	14: 56,131,342	R32C	probably damaging	Het
Hltf	T	A	3: 20,065,392	H200Q	probably benign	Het
Hrasls5	A	G	19: 7,614,581	T121A	probably benign	Het
Ift88	A	G	14: 57,479,997	I559M	probably damaging	Het
Ighv1-62-1	C	A	12: 115,386,702	C115F	probably damaging	Het
Impdh2	A	G	9: 108,563,437	N279S	possibly damaging	Het
Itpr1	T	C	6: 108,517,620		probably null	Het
Kansl1l	T	C	1: 66,801,628	N171S	possibly damaging	Het
Kif14	T	A	1: 136,468,753	C266S	probably benign	Het
Lrriq1	A	C	10: 103,215,973	V306G	probably damaging	Het
Mast4	G	A	13: 103,334,000	R65W	possibly damaging	Het
Mex3d	T	C	10: 80,387,257	D55G		Het
Mrps27	A	T	13: 99,411,280	K233*	probably null	Het
Myo1f	A	G	17: 33,579,928	N189S	probably damaging	Het
Nbn	A	T	4: 15,991,190	K729N	probably benign	Het
Olfr1082	C	A	2: 86,594,154	V225F	possibly damaging	Het
Olfr395	T	C	11: 73,907,232	S87G	probably benign	Het
Park2	C	A	17: 11,854,861	N355K	possibly damaging	Het
Pgghg	T	C	7: 140,945,720	S479P		Het
Polr1e	A	C	4: 45,029,340	H315P	probably damaging	Het
Pou6f2	A	G	13: 18,125,289	V595A		Het
Prdm15	T	C	16: 97,795,741	D960G	possibly damaging	Het
Prkcz	A	T	4: 155,269,059	M460K	probably benign	Het
Prkd2	G	T	7: 16,857,805	R587L	probably benign	Het
Rabep1	C	A	11: 70,939,989	T829N	probably damaging	Het
Rptn	A	G	3: 93,395,954	E198G	probably benign	Het
Ryr2	A	T	13: 11,665,913	I3182N	possibly damaging	Het
Sectm1a	T	A	11: 121,069,882	I36F	possibly damaging	Het
Sez6l	T	C	5: 112,473,480	S243G	probably benign	Het
Taf2	T	A	15: 55,062,141	H235L	probably benign	Het
Tbc1d7	T	C	13: 43,153,017	Q161R	probably benign	Het
Tfcp2	T	C	15: 100,518,587	T271A	possibly damaging	Het
Thrsp	G	T	7: 97,417,088	T139K	probably damaging	Het
Timm10	T	A	2: 84,829,989	*91R	probably null	Het
Tlr11	T	A	14: 50,362,141	I528N	possibly damaging	Het
Tnnt2	T	A	1: 135,851,706	L278Q	probably damaging	Het
Toe1	A	T	4: 116,807,518	M1K	probably null	Het
Trpv5	G	A	6: 41,675,308	R148*	probably null	Het
Ttll13	A	C	7: 80,254,163	K280Q	probably damaging	Het
Ttn	A	G	2: 76,953,206	V860A	unknown	Het
Txnip	T	C	3: 96,559,675	Y222H	probably damaging	Het
Ubr4	G	A	4: 139,443,414	S1600N	probably damaging	Het
Uhrf1	T	C	17: 56,315,193	Y364H	probably damaging	Het
Unc5a	A	T	13: 54,991,020	T71S	probably damaging	Het
Vmn1r123	A	T	7: 21,162,612	Y143F	possibly damaging	Het
Vmn1r180	T	A	7: 23,952,466	I18N	probably damaging	Het
Washc2	A	G	6: 116,208,207	M1V	probably null	Het
Zfp174	C	A	16: 3,848,247	H125Q	probably benign	Het
Zfpl1	T	C	19: 6,081,913	H227R	possibly damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTAAGGTTATGGCCATGCTTTG -3'
(R):5'- TCCCGGGACTATCAAGAGAC -3'

Sequencing Primer
(F):5'- TGGTACATGTCCTAGTAAGGGTTAC -3'
(R):5'- GGGACTATCAAGAGACACCACAG -3'

Posted On

2019-06-26