Incidental Mutation 'R7241:Acacb'
ID 563193
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 045348-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114383161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 2115 (A2115T)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect possibly damaging
Transcript: ENSMUST00000031583
AA Change: A2115T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: A2115T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102582
AA Change: A2115T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: A2115T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,846,184 (GRCm39) T612A probably damaging Het
Adam32 T C 8: 25,388,510 (GRCm39) K398R probably benign Het
Adam9 T A 8: 25,441,002 (GRCm39) I824F possibly damaging Het
Ahnak A G 19: 8,986,395 (GRCm39) I2560V possibly damaging Het
Ank3 G A 10: 69,542,644 (GRCm39) M1I probably null Het
Anks1b T G 10: 90,348,699 (GRCm39) I789S probably damaging Het
Ap2b1 T A 11: 83,241,931 (GRCm39) N641K probably benign Het
Arhgap33 A G 7: 30,228,146 (GRCm39) L412P probably damaging Het
Atp13a3 T A 16: 30,171,095 (GRCm39) M317L possibly damaging Het
B4galt5 A G 2: 167,148,617 (GRCm39) L167P probably damaging Het
Bace2 T C 16: 97,237,998 (GRCm39) I483T possibly damaging Het
C2cd3 A C 7: 100,056,257 (GRCm39) K177T Het
Ccr4 T C 9: 114,322,024 (GRCm39) T14A probably benign Het
Cep250 A T 2: 155,833,472 (GRCm39) H1799L probably benign Het
Cgnl1 T C 9: 71,632,052 (GRCm39) Q433R probably benign Het
Copb1 C T 7: 113,836,591 (GRCm39) V384M probably damaging Het
Cyp2c50 T A 19: 40,079,012 (GRCm39) N118K probably benign Het
Cyp4a32 A G 4: 115,459,499 (GRCm39) I78V probably benign Het
Cyth4 A G 15: 78,491,245 (GRCm39) K108R probably benign Het
Dnah1 T C 14: 30,986,896 (GRCm39) H3632R probably benign Het
Dnah3 T C 7: 119,542,856 (GRCm39) I540V probably benign Het
Dock4 A G 12: 40,844,859 (GRCm39) Y1174C probably damaging Het
Drd5 A G 5: 38,477,879 (GRCm39) T291A probably damaging Het
Eeig1 A G 2: 32,448,076 (GRCm39) R62G probably benign Het
Fbn1 T C 2: 125,148,415 (GRCm39) N2611S possibly damaging Het
Fcsk A G 8: 111,622,529 (GRCm39) I133T probably benign Het
Fhod3 A G 18: 25,193,409 (GRCm39) E640G probably damaging Het
Flvcr2 T A 12: 85,852,013 (GRCm39) D522E probably benign Het
Ganc T A 2: 120,272,010 (GRCm39) I556K probably damaging Het
Gjc2 T A 11: 59,067,960 (GRCm39) E174V unknown Het
Gzmd G A 14: 56,368,799 (GRCm39) R32C probably damaging Het
Hltf T A 3: 20,119,556 (GRCm39) H200Q probably benign Het
Ift88 A G 14: 57,717,454 (GRCm39) I559M probably damaging Het
Ighv1-62-1 C A 12: 115,350,322 (GRCm39) C115F probably damaging Het
Impdh2 A G 9: 108,440,636 (GRCm39) N279S possibly damaging Het
Itpr1 T C 6: 108,494,581 (GRCm39) probably null Het
Kansl1l T C 1: 66,840,787 (GRCm39) N171S possibly damaging Het
Kif14 T A 1: 136,396,491 (GRCm39) C266S probably benign Het
Kif19b A G 5: 140,447,943 (GRCm39) T137A probably damaging Het
Lrriq1 A C 10: 103,051,834 (GRCm39) V306G probably damaging Het
Mast4 G A 13: 103,470,508 (GRCm39) R65W possibly damaging Het
Mex3d T C 10: 80,223,091 (GRCm39) D55G Het
Mrps27 A T 13: 99,547,788 (GRCm39) K233* probably null Het
Myo1f A G 17: 33,798,902 (GRCm39) N189S probably damaging Het
Nbn A T 4: 15,991,190 (GRCm39) K729N probably benign Het
Or1e35 T C 11: 73,798,058 (GRCm39) S87G probably benign Het
Or8k35 C A 2: 86,424,498 (GRCm39) V225F possibly damaging Het
Pgghg T C 7: 140,525,633 (GRCm39) S479P Het
Plaat5 A G 19: 7,591,946 (GRCm39) T121A probably benign Het
Polr1e A C 4: 45,029,340 (GRCm39) H315P probably damaging Het
Pou6f2 A G 13: 18,299,874 (GRCm39) V595A Het
Prdm15 T C 16: 97,596,941 (GRCm39) D960G possibly damaging Het
Prkcz A T 4: 155,353,516 (GRCm39) M460K probably benign Het
Prkd2 G T 7: 16,591,730 (GRCm39) R587L probably benign Het
Prkn C A 17: 12,073,748 (GRCm39) N355K possibly damaging Het
Rabep1 C A 11: 70,830,815 (GRCm39) T829N probably damaging Het
Rptn A G 3: 93,303,261 (GRCm39) E198G probably benign Het
Ryr2 A T 13: 11,680,799 (GRCm39) I3182N possibly damaging Het
Sectm1a T A 11: 120,960,708 (GRCm39) I36F possibly damaging Het
Sez6l T C 5: 112,621,346 (GRCm39) S243G probably benign Het
Spata31h1 T C 10: 82,122,876 (GRCm39) E3378G probably benign Het
Taf2 T A 15: 54,925,537 (GRCm39) H235L probably benign Het
Tbc1d7 T C 13: 43,306,493 (GRCm39) Q161R probably benign Het
Tfcp2 T C 15: 100,416,468 (GRCm39) T271A possibly damaging Het
Thrsp G T 7: 97,066,295 (GRCm39) T139K probably damaging Het
Timm10 T A 2: 84,660,333 (GRCm39) *91R probably null Het
Tlr11 T A 14: 50,599,598 (GRCm39) I528N possibly damaging Het
Tnnt2 T A 1: 135,779,444 (GRCm39) L278Q probably damaging Het
Toe1 A T 4: 116,664,715 (GRCm39) M1K probably null Het
Trpv5 G A 6: 41,652,242 (GRCm39) R148* probably null Het
Ttll13 A C 7: 79,903,911 (GRCm39) K280Q probably damaging Het
Ttn A G 2: 76,783,550 (GRCm39) V860A unknown Het
Txnip T C 3: 96,466,991 (GRCm39) Y222H probably damaging Het
Ubr4 G A 4: 139,170,725 (GRCm39) S1600N probably damaging Het
Uhrf1 T C 17: 56,622,193 (GRCm39) Y364H probably damaging Het
Unc5a A T 13: 55,138,833 (GRCm39) T71S probably damaging Het
Vmn1r123 A T 7: 20,896,537 (GRCm39) Y143F possibly damaging Het
Vmn1r180 T A 7: 23,651,891 (GRCm39) I18N probably damaging Het
Washc2 A G 6: 116,185,168 (GRCm39) M1V probably null Het
Zfp174 C A 16: 3,666,111 (GRCm39) H125Q probably benign Het
Zfpl1 T C 19: 6,131,943 (GRCm39) H227R possibly damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTAAGGTTATGGCCATGCTTTG -3'
(R):5'- TCCCGGGACTATCAAGAGAC -3'

Sequencing Primer
(F):5'- TGGTACATGTCCTAGTAAGGGTTAC -3'
(R):5'- GGGACTATCAAGAGACACCACAG -3'
Posted On 2019-06-26