Incidental Mutation 'R7241:Washc2'
ID563197
Institutional Source Beutler Lab
Gene Symbol Washc2
Ensembl Gene ENSMUSG00000024104
Gene NameWASH complex subunit 2`
SynonymsFam21, D6Wsu116e, C530005J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7241 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116208038-116262686 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 116208207 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000038983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036759] [ENSMUST00000203286] [ENSMUST00000203523] [ENSMUST00000204051] [ENSMUST00000204283] [ENSMUST00000204476]
Predicted Effect probably null
Transcript: ENSMUST00000036759
AA Change: M1V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000038983
Gene: ENSMUSG00000024104
AA Change: M1V

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:CAP-ZIP_m 939 1074 4.3e-58 PFAM
low complexity region 1268 1282 N/A INTRINSIC
low complexity region 1297 1317 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203286
AA Change: M1V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably null
Transcript: ENSMUST00000203523
AA Change: M1V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000204051
Predicted Effect probably benign
Transcript: ENSMUST00000204283
SMART Domains Protein: ENSMUSP00000144703
Gene: ENSMUSG00000024104

DomainStartEndE-ValueType
coiled coil region 9 43 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 130 152 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
low complexity region 357 369 N/A INTRINSIC
low complexity region 445 475 N/A INTRINSIC
low complexity region 574 582 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
Pfam:CAP-ZIP_m 853 988 2.8e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204476
AA Change: M1V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000144982
Gene: ENSMUSG00000024104
AA Change: M1V

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,287,042 E3378G probably benign Het
Abca14 A G 7: 120,246,961 T612A probably damaging Het
Acacb G A 5: 114,245,100 A2115T possibly damaging Het
Adam32 T C 8: 24,898,494 K398R probably benign Het
Adam9 T A 8: 24,950,986 I824F possibly damaging Het
Ahnak A G 19: 9,009,031 I2560V possibly damaging Het
Ank3 G A 10: 69,706,814 M1I probably null Het
Anks1b T G 10: 90,512,837 I789S probably damaging Het
Ap2b1 T A 11: 83,351,105 N641K probably benign Het
Arhgap33 A G 7: 30,528,721 L412P probably damaging Het
Atp13a3 T A 16: 30,352,277 M317L possibly damaging Het
B4galt5 A G 2: 167,306,697 L167P probably damaging Het
Bace2 T C 16: 97,436,798 I483T possibly damaging Het
C2cd3 A C 7: 100,407,050 K177T Het
Ccr4 T C 9: 114,492,956 T14A probably benign Het
Cep250 A T 2: 155,991,552 H1799L probably benign Het
Cgnl1 T C 9: 71,724,770 Q433R probably benign Het
Copb1 C T 7: 114,237,356 V384M probably damaging Het
Cyp2c50 T A 19: 40,090,568 N118K probably benign Het
Cyp4a32 A G 4: 115,602,302 I78V probably benign Het
Cyth4 A G 15: 78,607,045 K108R probably benign Het
Dnah1 T C 14: 31,264,939 H3632R probably benign Het
Dnah3 T C 7: 119,943,633 I540V probably benign Het
Dock4 A G 12: 40,794,860 Y1174C probably damaging Het
Drd5 A G 5: 38,320,536 T291A probably damaging Het
Fam102a A G 2: 32,558,064 R62G probably benign Het
Fbn1 T C 2: 125,306,495 N2611S possibly damaging Het
Fhod3 A G 18: 25,060,352 E640G probably damaging Het
Flvcr2 T A 12: 85,805,239 D522E probably benign Het
Fuk A G 8: 110,895,897 I133T probably benign Het
Ganc T A 2: 120,441,529 I556K probably damaging Het
Gjc2 T A 11: 59,177,134 E174V unknown Het
Gm4869 A G 5: 140,462,188 T137A probably damaging Het
Gzmd G A 14: 56,131,342 R32C probably damaging Het
Hltf T A 3: 20,065,392 H200Q probably benign Het
Hrasls5 A G 19: 7,614,581 T121A probably benign Het
Ift88 A G 14: 57,479,997 I559M probably damaging Het
Ighv1-62-1 C A 12: 115,386,702 C115F probably damaging Het
Impdh2 A G 9: 108,563,437 N279S possibly damaging Het
Itpr1 T C 6: 108,517,620 probably null Het
Kansl1l T C 1: 66,801,628 N171S possibly damaging Het
Kif14 T A 1: 136,468,753 C266S probably benign Het
Lrriq1 A C 10: 103,215,973 V306G probably damaging Het
Mast4 G A 13: 103,334,000 R65W possibly damaging Het
Mex3d T C 10: 80,387,257 D55G Het
Mrps27 A T 13: 99,411,280 K233* probably null Het
Myo1f A G 17: 33,579,928 N189S probably damaging Het
Nbn A T 4: 15,991,190 K729N probably benign Het
Olfr1082 C A 2: 86,594,154 V225F possibly damaging Het
Olfr395 T C 11: 73,907,232 S87G probably benign Het
Park2 C A 17: 11,854,861 N355K possibly damaging Het
Pgghg T C 7: 140,945,720 S479P Het
Polr1e A C 4: 45,029,340 H315P probably damaging Het
Pou6f2 A G 13: 18,125,289 V595A Het
Prdm15 T C 16: 97,795,741 D960G possibly damaging Het
Prkcz A T 4: 155,269,059 M460K probably benign Het
Prkd2 G T 7: 16,857,805 R587L probably benign Het
Rabep1 C A 11: 70,939,989 T829N probably damaging Het
Rptn A G 3: 93,395,954 E198G probably benign Het
Ryr2 A T 13: 11,665,913 I3182N possibly damaging Het
Sectm1a T A 11: 121,069,882 I36F possibly damaging Het
Sez6l T C 5: 112,473,480 S243G probably benign Het
Taf2 T A 15: 55,062,141 H235L probably benign Het
Tbc1d7 T C 13: 43,153,017 Q161R probably benign Het
Tfcp2 T C 15: 100,518,587 T271A possibly damaging Het
Thrsp G T 7: 97,417,088 T139K probably damaging Het
Timm10 T A 2: 84,829,989 *91R probably null Het
Tlr11 T A 14: 50,362,141 I528N possibly damaging Het
Tnnt2 T A 1: 135,851,706 L278Q probably damaging Het
Toe1 A T 4: 116,807,518 M1K probably null Het
Trpv5 G A 6: 41,675,308 R148* probably null Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Ttn A G 2: 76,953,206 V860A unknown Het
Txnip T C 3: 96,559,675 Y222H probably damaging Het
Ubr4 G A 4: 139,443,414 S1600N probably damaging Het
Uhrf1 T C 17: 56,315,193 Y364H probably damaging Het
Unc5a A T 13: 54,991,020 T71S probably damaging Het
Vmn1r123 A T 7: 21,162,612 Y143F possibly damaging Het
Vmn1r180 T A 7: 23,952,466 I18N probably damaging Het
Zfp174 C A 16: 3,848,247 H125Q probably benign Het
Zfpl1 T C 19: 6,081,913 H227R possibly damaging Het
Other mutations in Washc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Washc2 APN 6 116256676 missense probably benign
IGL00552:Washc2 APN 6 116256824 missense possibly damaging 0.85
IGL01397:Washc2 APN 6 116247998 missense probably benign 0.44
IGL01668:Washc2 APN 6 116262338 missense probably damaging 1.00
IGL01982:Washc2 APN 6 116236189 missense probably benign 0.22
IGL02022:Washc2 APN 6 116259165 missense probably benign 0.22
IGL02150:Washc2 APN 6 116231632 splice site probably benign
IGL02224:Washc2 APN 6 116220569 missense possibly damaging 0.70
IGL02553:Washc2 APN 6 116241610 missense probably damaging 0.98
IGL02555:Washc2 APN 6 116209100 missense probably damaging 1.00
IGL02612:Washc2 APN 6 116220616 missense possibly damaging 0.90
IGL02622:Washc2 APN 6 116214018 splice site probably benign
IGL02900:Washc2 APN 6 116227474 missense probably damaging 1.00
IGL03263:Washc2 APN 6 116238123 splice site probably benign
fading UTSW 6 116254153 missense probably damaging 1.00
R0218:Washc2 UTSW 6 116248046 nonsense probably null
R0285:Washc2 UTSW 6 116221839 missense probably damaging 1.00
R0346:Washc2 UTSW 6 116220523 splice site probably benign
R0677:Washc2 UTSW 6 116244616 missense probably damaging 1.00
R0919:Washc2 UTSW 6 116208264 missense probably damaging 1.00
R1144:Washc2 UTSW 6 116224534 missense probably damaging 1.00
R1666:Washc2 UTSW 6 116223254 critical splice donor site probably null
R1687:Washc2 UTSW 6 116256712 missense probably benign 0.06
R1702:Washc2 UTSW 6 116229306 missense probably damaging 0.99
R1740:Washc2 UTSW 6 116231632 splice site probably benign
R1952:Washc2 UTSW 6 116255091 missense possibly damaging 0.92
R1964:Washc2 UTSW 6 116208987 missense probably damaging 0.99
R2039:Washc2 UTSW 6 116224439 missense probably damaging 0.99
R3084:Washc2 UTSW 6 116227493 missense probably benign 0.00
R3552:Washc2 UTSW 6 116220568 missense probably damaging 1.00
R3790:Washc2 UTSW 6 116247972 splice site probably benign
R3949:Washc2 UTSW 6 116208204 utr 5 prime probably benign
R4089:Washc2 UTSW 6 116256292 splice site probably null
R4133:Washc2 UTSW 6 116258930 missense probably damaging 0.99
R4258:Washc2 UTSW 6 116208241 missense probably damaging 1.00
R4510:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4511:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4613:Washc2 UTSW 6 116229269 missense probably damaging 1.00
R4614:Washc2 UTSW 6 116238174 missense possibly damaging 0.83
R4794:Washc2 UTSW 6 116258649 missense probably benign 0.03
R5224:Washc2 UTSW 6 116209004 makesense probably null
R5367:Washc2 UTSW 6 116259150 missense probably damaging 1.00
R5602:Washc2 UTSW 6 116248095 missense possibly damaging 0.73
R6013:Washc2 UTSW 6 116254153 missense probably damaging 1.00
R6075:Washc2 UTSW 6 116227366 missense probably benign 0.02
R6086:Washc2 UTSW 6 116256216 splice site probably null
R6344:Washc2 UTSW 6 116258758 missense probably benign 0.08
R6593:Washc2 UTSW 6 116259249 missense probably damaging 1.00
R7048:Washc2 UTSW 6 116220583 missense possibly damaging 0.96
R7062:Washc2 UTSW 6 116219988 missense possibly damaging 0.72
R7283:Washc2 UTSW 6 116227418 missense probably damaging 0.99
R7681:Washc2 UTSW 6 116260657 missense probably damaging 0.99
R7810:Washc2 UTSW 6 116259059 missense probably benign
R7908:Washc2 UTSW 6 116248145 missense probably benign
R7923:Washc2 UTSW 6 116226424 missense possibly damaging 0.83
R8067:Washc2 UTSW 6 116224503 missense probably damaging 0.99
R8697:Washc2 UTSW 6 116229259 missense probably benign 0.17
R8841:Washc2 UTSW 6 116258955 missense probably benign 0.16
R8920:Washc2 UTSW 6 116244654 missense possibly damaging 0.92
X0018:Washc2 UTSW 6 116208258 missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- TCACGTGAGGACACCATCAC -3'
(R):5'- CTTTGAATACTGGAGGAAGCGTG -3'

Sequencing Primer
(F):5'- CGTGACGTGAACCATGTGATTACC -3'
(R):5'- TGGAGGAAGCGTGTCCCC -3'
Posted On2019-06-26