Incidental Mutation 'R0578:Best3'
Institutional Source Beutler Lab
Gene Symbol Best3
Ensembl Gene ENSMUSG00000020169
Gene Namebestrophin 3
SynonymsmBest4, Vmd2l3
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosomal Location116986314-117025040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117008999 bp
Amino Acid Change Aspartic acid to Glycine at position 353 (D353G)
Ref Sequence ENSEMBL: ENSMUSP00000020378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020378]
Predicted Effect probably benign
Transcript: ENSMUST00000020378
AA Change: D353G

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020378
Gene: ENSMUSG00000020169
AA Change: D353G

Pfam:Bestrophin 8 316 7.3e-115 PFAM
low complexity region 405 416 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
Meta Mutation Damage Score 0.1109 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Best3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Best3 APN 10 116988727 missense probably damaging 1.00
IGL00158:Best3 APN 10 117004541 splice site probably benign
IGL02493:Best3 APN 10 117024601 missense possibly damaging 0.95
IGL02713:Best3 APN 10 117024529 missense probably benign 0.00
IGL03178:Best3 APN 10 116988779 missense probably damaging 1.00
IGL03355:Best3 APN 10 116993105 missense possibly damaging 0.82
R0531:Best3 UTSW 10 117004375 splice site probably benign
R1671:Best3 UTSW 10 117024668 missense possibly damaging 0.58
R1769:Best3 UTSW 10 117023978 missense probably benign 0.00
R1860:Best3 UTSW 10 116993273 missense probably damaging 1.00
R1935:Best3 UTSW 10 117024386 missense probably benign
R2103:Best3 UTSW 10 117002594 missense probably benign 0.01
R3942:Best3 UTSW 10 116988674 missense possibly damaging 0.49
R4260:Best3 UTSW 10 117024226 missense probably benign
R4332:Best3 UTSW 10 117002524 missense probably benign 0.37
R4741:Best3 UTSW 10 117023996 missense probably benign 0.06
R4760:Best3 UTSW 10 117024794 missense probably benign 0.00
R4896:Best3 UTSW 10 117024555 missense probably benign 0.00
R4912:Best3 UTSW 10 117008981 missense probably damaging 1.00
R5023:Best3 UTSW 10 116988742 missense probably benign 0.06
R5087:Best3 UTSW 10 117009002 missense probably benign 0.01
R5213:Best3 UTSW 10 117024472 missense probably benign 0.01
R5457:Best3 UTSW 10 117004511 missense probably damaging 1.00
R5928:Best3 UTSW 10 117007627 missense probably damaging 1.00
R5982:Best3 UTSW 10 117004417 missense probably damaging 0.98
R6335:Best3 UTSW 10 117002651 missense probably benign 0.32
R7068:Best3 UTSW 10 116988638 missense probably damaging 1.00
R7469:Best3 UTSW 10 117004385 missense probably damaging 1.00
RF014:Best3 UTSW 10 117004505 missense probably damaging 1.00
Z1088:Best3 UTSW 10 117024170 missense probably benign 0.00
Z1176:Best3 UTSW 10 117024622 missense probably benign 0.24
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gctgaccctacaaagttgcc -3'
Posted On2013-07-11