Incidental Mutation 'R0578:Olfr767'
ID56321
Institutional Source Beutler Lab
Gene Symbol Olfr767
Ensembl Gene ENSMUSG00000059762
Gene Nameolfactory receptor 767
SynonymsMOR115-1, GA_x6K02T2PULF-10765431-10764502
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129074825-129082910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129079193 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 257 (Y257H)
Ref Sequence ENSEMBL: ENSMUSP00000150151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082131] [ENSMUST00000213579]
Predicted Effect probably damaging
Transcript: ENSMUST00000082131
AA Change: Y257H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080775
Gene: ENSMUSG00000059762
AA Change: Y257H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.9e-49 PFAM
Pfam:7tm_1 39 288 3.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213579
AA Change: Y257H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1681 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Olfr767
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Olfr767 APN 10 129079355 missense probably benign 0.13
IGL01945:Olfr767 APN 10 129079303 missense probably damaging 1.00
IGL02341:Olfr767 APN 10 129079461 nonsense probably null
IGL02389:Olfr767 APN 10 129079230 missense probably damaging 0.97
IGL02516:Olfr767 APN 10 129079793 missense possibly damaging 0.95
IGL02755:Olfr767 APN 10 129079196 missense probably benign 0.00
R0145:Olfr767 UTSW 10 129079363 missense probably damaging 0.97
R0453:Olfr767 UTSW 10 129079771 missense probably damaging 0.97
R1034:Olfr767 UTSW 10 129079961 start codon destroyed probably benign 0.43
R1494:Olfr767 UTSW 10 129079615 missense probably damaging 1.00
R1941:Olfr767 UTSW 10 129079954 missense probably damaging 0.99
R3707:Olfr767 UTSW 10 129079385 missense probably benign 0.31
R5405:Olfr767 UTSW 10 129079396 missense probably damaging 0.99
R5716:Olfr767 UTSW 10 129079555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTTGGCACACAGTAGGAACTC -3'
(R):5'- TCAGCAGAACTTCTGTGCATCCAAC -3'

Sequencing Primer
(F):5'- CACACAGTAGGAACTCATTCATTAAG -3'
(R):5'- TAGAACTCTCCTGTTCTGACACAAG -3'
Posted On2013-07-11