Incidental Mutation 'R7241:Rabep1'
ID 563221
Institutional Source Beutler Lab
Gene Symbol Rabep1
Ensembl Gene ENSMUSG00000020817
Gene Name rabaptin, RAB GTPase binding effector protein 1
Synonyms rabaptin-5, RAB5 effector protein, neurocrescin
MMRRC Submission 045348-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.559) question?
Stock # R7241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 70735604-70833931 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70830815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 829 (T829N)
Ref Sequence ENSEMBL: ENSMUSP00000104173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035283] [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108530] [ENSMUST00000108531] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
AlphaFold O35551
Predicted Effect probably benign
Transcript: ENSMUST00000035283
SMART Domains Protein: ENSMUSP00000048101
Gene: ENSMUSG00000040667

DomainStartEndE-ValueType
Pfam:Nup88 13 752 1.1e-306 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076270
AA Change: T827N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817
AA Change: T827N

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081362
AA Change: T787N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817
AA Change: T787N

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100928
AA Change: T792N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817
AA Change: T792N

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108530
SMART Domains Protein: ENSMUSP00000104170
Gene: ENSMUSG00000040667

DomainStartEndE-ValueType
Pfam:Nup88 11 742 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108531
SMART Domains Protein: ENSMUSP00000104171
Gene: ENSMUSG00000040667

DomainStartEndE-ValueType
Pfam:Nup88 11 747 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108533
AA Change: T829N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817
AA Change: T829N

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177731
AA Change: T743N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817
AA Change: T743N

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178245
AA Change: T784N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817
AA Change: T784N

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178253
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,846,184 (GRCm39) T612A probably damaging Het
Acacb G A 5: 114,383,161 (GRCm39) A2115T possibly damaging Het
Adam32 T C 8: 25,388,510 (GRCm39) K398R probably benign Het
Adam9 T A 8: 25,441,002 (GRCm39) I824F possibly damaging Het
Ahnak A G 19: 8,986,395 (GRCm39) I2560V possibly damaging Het
Ank3 G A 10: 69,542,644 (GRCm39) M1I probably null Het
Anks1b T G 10: 90,348,699 (GRCm39) I789S probably damaging Het
Ap2b1 T A 11: 83,241,931 (GRCm39) N641K probably benign Het
Arhgap33 A G 7: 30,228,146 (GRCm39) L412P probably damaging Het
Atp13a3 T A 16: 30,171,095 (GRCm39) M317L possibly damaging Het
B4galt5 A G 2: 167,148,617 (GRCm39) L167P probably damaging Het
Bace2 T C 16: 97,237,998 (GRCm39) I483T possibly damaging Het
C2cd3 A C 7: 100,056,257 (GRCm39) K177T Het
Ccr4 T C 9: 114,322,024 (GRCm39) T14A probably benign Het
Cep250 A T 2: 155,833,472 (GRCm39) H1799L probably benign Het
Cgnl1 T C 9: 71,632,052 (GRCm39) Q433R probably benign Het
Copb1 C T 7: 113,836,591 (GRCm39) V384M probably damaging Het
Cyp2c50 T A 19: 40,079,012 (GRCm39) N118K probably benign Het
Cyp4a32 A G 4: 115,459,499 (GRCm39) I78V probably benign Het
Cyth4 A G 15: 78,491,245 (GRCm39) K108R probably benign Het
Dnah1 T C 14: 30,986,896 (GRCm39) H3632R probably benign Het
Dnah3 T C 7: 119,542,856 (GRCm39) I540V probably benign Het
Dock4 A G 12: 40,844,859 (GRCm39) Y1174C probably damaging Het
Drd5 A G 5: 38,477,879 (GRCm39) T291A probably damaging Het
Eeig1 A G 2: 32,448,076 (GRCm39) R62G probably benign Het
Fbn1 T C 2: 125,148,415 (GRCm39) N2611S possibly damaging Het
Fcsk A G 8: 111,622,529 (GRCm39) I133T probably benign Het
Fhod3 A G 18: 25,193,409 (GRCm39) E640G probably damaging Het
Flvcr2 T A 12: 85,852,013 (GRCm39) D522E probably benign Het
Ganc T A 2: 120,272,010 (GRCm39) I556K probably damaging Het
Gjc2 T A 11: 59,067,960 (GRCm39) E174V unknown Het
Gzmd G A 14: 56,368,799 (GRCm39) R32C probably damaging Het
Hltf T A 3: 20,119,556 (GRCm39) H200Q probably benign Het
Ift88 A G 14: 57,717,454 (GRCm39) I559M probably damaging Het
Ighv1-62-1 C A 12: 115,350,322 (GRCm39) C115F probably damaging Het
Impdh2 A G 9: 108,440,636 (GRCm39) N279S possibly damaging Het
Itpr1 T C 6: 108,494,581 (GRCm39) probably null Het
Kansl1l T C 1: 66,840,787 (GRCm39) N171S possibly damaging Het
Kif14 T A 1: 136,396,491 (GRCm39) C266S probably benign Het
Kif19b A G 5: 140,447,943 (GRCm39) T137A probably damaging Het
Lrriq1 A C 10: 103,051,834 (GRCm39) V306G probably damaging Het
Mast4 G A 13: 103,470,508 (GRCm39) R65W possibly damaging Het
Mex3d T C 10: 80,223,091 (GRCm39) D55G Het
Mrps27 A T 13: 99,547,788 (GRCm39) K233* probably null Het
Myo1f A G 17: 33,798,902 (GRCm39) N189S probably damaging Het
Nbn A T 4: 15,991,190 (GRCm39) K729N probably benign Het
Or1e35 T C 11: 73,798,058 (GRCm39) S87G probably benign Het
Or8k35 C A 2: 86,424,498 (GRCm39) V225F possibly damaging Het
Pgghg T C 7: 140,525,633 (GRCm39) S479P Het
Plaat5 A G 19: 7,591,946 (GRCm39) T121A probably benign Het
Polr1e A C 4: 45,029,340 (GRCm39) H315P probably damaging Het
Pou6f2 A G 13: 18,299,874 (GRCm39) V595A Het
Prdm15 T C 16: 97,596,941 (GRCm39) D960G possibly damaging Het
Prkcz A T 4: 155,353,516 (GRCm39) M460K probably benign Het
Prkd2 G T 7: 16,591,730 (GRCm39) R587L probably benign Het
Prkn C A 17: 12,073,748 (GRCm39) N355K possibly damaging Het
Rptn A G 3: 93,303,261 (GRCm39) E198G probably benign Het
Ryr2 A T 13: 11,680,799 (GRCm39) I3182N possibly damaging Het
Sectm1a T A 11: 120,960,708 (GRCm39) I36F possibly damaging Het
Sez6l T C 5: 112,621,346 (GRCm39) S243G probably benign Het
Spata31h1 T C 10: 82,122,876 (GRCm39) E3378G probably benign Het
Taf2 T A 15: 54,925,537 (GRCm39) H235L probably benign Het
Tbc1d7 T C 13: 43,306,493 (GRCm39) Q161R probably benign Het
Tfcp2 T C 15: 100,416,468 (GRCm39) T271A possibly damaging Het
Thrsp G T 7: 97,066,295 (GRCm39) T139K probably damaging Het
Timm10 T A 2: 84,660,333 (GRCm39) *91R probably null Het
Tlr11 T A 14: 50,599,598 (GRCm39) I528N possibly damaging Het
Tnnt2 T A 1: 135,779,444 (GRCm39) L278Q probably damaging Het
Toe1 A T 4: 116,664,715 (GRCm39) M1K probably null Het
Trpv5 G A 6: 41,652,242 (GRCm39) R148* probably null Het
Ttll13 A C 7: 79,903,911 (GRCm39) K280Q probably damaging Het
Ttn A G 2: 76,783,550 (GRCm39) V860A unknown Het
Txnip T C 3: 96,466,991 (GRCm39) Y222H probably damaging Het
Ubr4 G A 4: 139,170,725 (GRCm39) S1600N probably damaging Het
Uhrf1 T C 17: 56,622,193 (GRCm39) Y364H probably damaging Het
Unc5a A T 13: 55,138,833 (GRCm39) T71S probably damaging Het
Vmn1r123 A T 7: 20,896,537 (GRCm39) Y143F possibly damaging Het
Vmn1r180 T A 7: 23,651,891 (GRCm39) I18N probably damaging Het
Washc2 A G 6: 116,185,168 (GRCm39) M1V probably null Het
Zfp174 C A 16: 3,666,111 (GRCm39) H125Q probably benign Het
Zfpl1 T C 19: 6,131,943 (GRCm39) H227R possibly damaging Het
Other mutations in Rabep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rabep1 APN 11 70,816,607 (GRCm39) missense probably benign 0.00
IGL02022:Rabep1 APN 11 70,825,385 (GRCm39) missense probably damaging 1.00
IGL02215:Rabep1 APN 11 70,814,023 (GRCm39) nonsense probably null
IGL02428:Rabep1 APN 11 70,808,306 (GRCm39) missense probably benign 0.00
IGL02566:Rabep1 APN 11 70,808,540 (GRCm39) missense probably damaging 1.00
IGL02868:Rabep1 APN 11 70,765,572 (GRCm39) missense probably benign 0.00
F5770:Rabep1 UTSW 11 70,828,342 (GRCm39) splice site probably benign
P0042:Rabep1 UTSW 11 70,775,801 (GRCm39) splice site probably benign
PIT4495001:Rabep1 UTSW 11 70,808,405 (GRCm39) missense probably damaging 1.00
R0328:Rabep1 UTSW 11 70,810,033 (GRCm39) missense probably damaging 1.00
R0458:Rabep1 UTSW 11 70,777,824 (GRCm39) splice site probably null
R0477:Rabep1 UTSW 11 70,811,733 (GRCm39) missense probably damaging 1.00
R0727:Rabep1 UTSW 11 70,791,318 (GRCm39) nonsense probably null
R1732:Rabep1 UTSW 11 70,795,467 (GRCm39) missense probably damaging 1.00
R1837:Rabep1 UTSW 11 70,795,484 (GRCm39) missense probably damaging 1.00
R2203:Rabep1 UTSW 11 70,825,400 (GRCm39) missense probably damaging 1.00
R4003:Rabep1 UTSW 11 70,808,193 (GRCm39) missense probably benign 0.12
R4229:Rabep1 UTSW 11 70,799,260 (GRCm39) missense probably benign
R4573:Rabep1 UTSW 11 70,808,577 (GRCm39) missense probably damaging 1.00
R4748:Rabep1 UTSW 11 70,799,294 (GRCm39) missense probably benign 0.18
R5130:Rabep1 UTSW 11 70,795,557 (GRCm39) missense probably damaging 1.00
R5182:Rabep1 UTSW 11 70,795,454 (GRCm39) nonsense probably null
R5379:Rabep1 UTSW 11 70,799,247 (GRCm39) missense probably damaging 1.00
R5525:Rabep1 UTSW 11 70,813,972 (GRCm39) missense probably damaging 1.00
R5617:Rabep1 UTSW 11 70,808,355 (GRCm39) missense probably damaging 1.00
R6283:Rabep1 UTSW 11 70,808,505 (GRCm39) missense probably damaging 1.00
R6302:Rabep1 UTSW 11 70,825,947 (GRCm39) missense probably damaging 1.00
R6730:Rabep1 UTSW 11 70,831,212 (GRCm39) missense possibly damaging 0.88
R6988:Rabep1 UTSW 11 70,825,363 (GRCm39) missense probably damaging 0.96
R7235:Rabep1 UTSW 11 70,831,290 (GRCm39) missense probably benign 0.43
R7453:Rabep1 UTSW 11 70,808,486 (GRCm39) missense probably damaging 1.00
R7955:Rabep1 UTSW 11 70,808,267 (GRCm39) missense probably damaging 0.96
R8175:Rabep1 UTSW 11 70,775,755 (GRCm39) missense probably damaging 1.00
R8314:Rabep1 UTSW 11 70,784,486 (GRCm39) missense possibly damaging 0.93
R8461:Rabep1 UTSW 11 70,775,681 (GRCm39) missense possibly damaging 0.56
R8481:Rabep1 UTSW 11 70,777,953 (GRCm39) missense probably damaging 1.00
R8530:Rabep1 UTSW 11 70,810,068 (GRCm39) missense probably damaging 1.00
R8531:Rabep1 UTSW 11 70,799,332 (GRCm39) missense probably benign 0.01
R9010:Rabep1 UTSW 11 70,810,034 (GRCm39) missense probably damaging 1.00
R9696:Rabep1 UTSW 11 70,814,029 (GRCm39) missense probably benign
Z1186:Rabep1 UTSW 11 70,830,910 (GRCm39) frame shift probably null
Z1187:Rabep1 UTSW 11 70,830,910 (GRCm39) frame shift probably null
Z1188:Rabep1 UTSW 11 70,830,910 (GRCm39) frame shift probably null
Z1189:Rabep1 UTSW 11 70,830,910 (GRCm39) frame shift probably null
Z1190:Rabep1 UTSW 11 70,830,910 (GRCm39) frame shift probably null
Z1191:Rabep1 UTSW 11 70,830,910 (GRCm39) frame shift probably null
Z1192:Rabep1 UTSW 11 70,830,910 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGCAGAGCAGTGTAGTGGC -3'
(R):5'- ACAGACTGGTATCCCTCAGC -3'

Sequencing Primer
(F):5'- GTAGTGGCTCTTGAGAATCATCACTC -3'
(R):5'- CACTCAACCTGATGATACGTTGAAGG -3'
Posted On 2019-06-26