Incidental Mutation 'R7241:Ahnak'
ID 563251
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene Name AHNAK nucleoprotein
Synonyms DY6, 1110004P15Rik, 2310047C17Rik
MMRRC Submission 045348-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R7241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 8966648-9054278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8986395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 2560 (I2560V)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092956
AA Change: I2560V

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: I2560V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,846,184 (GRCm39) T612A probably damaging Het
Acacb G A 5: 114,383,161 (GRCm39) A2115T possibly damaging Het
Adam32 T C 8: 25,388,510 (GRCm39) K398R probably benign Het
Adam9 T A 8: 25,441,002 (GRCm39) I824F possibly damaging Het
Ank3 G A 10: 69,542,644 (GRCm39) M1I probably null Het
Anks1b T G 10: 90,348,699 (GRCm39) I789S probably damaging Het
Ap2b1 T A 11: 83,241,931 (GRCm39) N641K probably benign Het
Arhgap33 A G 7: 30,228,146 (GRCm39) L412P probably damaging Het
Atp13a3 T A 16: 30,171,095 (GRCm39) M317L possibly damaging Het
B4galt5 A G 2: 167,148,617 (GRCm39) L167P probably damaging Het
Bace2 T C 16: 97,237,998 (GRCm39) I483T possibly damaging Het
C2cd3 A C 7: 100,056,257 (GRCm39) K177T Het
Ccr4 T C 9: 114,322,024 (GRCm39) T14A probably benign Het
Cep250 A T 2: 155,833,472 (GRCm39) H1799L probably benign Het
Cgnl1 T C 9: 71,632,052 (GRCm39) Q433R probably benign Het
Copb1 C T 7: 113,836,591 (GRCm39) V384M probably damaging Het
Cyp2c50 T A 19: 40,079,012 (GRCm39) N118K probably benign Het
Cyp4a32 A G 4: 115,459,499 (GRCm39) I78V probably benign Het
Cyth4 A G 15: 78,491,245 (GRCm39) K108R probably benign Het
Dnah1 T C 14: 30,986,896 (GRCm39) H3632R probably benign Het
Dnah3 T C 7: 119,542,856 (GRCm39) I540V probably benign Het
Dock4 A G 12: 40,844,859 (GRCm39) Y1174C probably damaging Het
Drd5 A G 5: 38,477,879 (GRCm39) T291A probably damaging Het
Eeig1 A G 2: 32,448,076 (GRCm39) R62G probably benign Het
Fbn1 T C 2: 125,148,415 (GRCm39) N2611S possibly damaging Het
Fcsk A G 8: 111,622,529 (GRCm39) I133T probably benign Het
Fhod3 A G 18: 25,193,409 (GRCm39) E640G probably damaging Het
Flvcr2 T A 12: 85,852,013 (GRCm39) D522E probably benign Het
Ganc T A 2: 120,272,010 (GRCm39) I556K probably damaging Het
Gjc2 T A 11: 59,067,960 (GRCm39) E174V unknown Het
Gzmd G A 14: 56,368,799 (GRCm39) R32C probably damaging Het
Hltf T A 3: 20,119,556 (GRCm39) H200Q probably benign Het
Ift88 A G 14: 57,717,454 (GRCm39) I559M probably damaging Het
Ighv1-62-1 C A 12: 115,350,322 (GRCm39) C115F probably damaging Het
Impdh2 A G 9: 108,440,636 (GRCm39) N279S possibly damaging Het
Itpr1 T C 6: 108,494,581 (GRCm39) probably null Het
Kansl1l T C 1: 66,840,787 (GRCm39) N171S possibly damaging Het
Kif14 T A 1: 136,396,491 (GRCm39) C266S probably benign Het
Kif19b A G 5: 140,447,943 (GRCm39) T137A probably damaging Het
Lrriq1 A C 10: 103,051,834 (GRCm39) V306G probably damaging Het
Mast4 G A 13: 103,470,508 (GRCm39) R65W possibly damaging Het
Mex3d T C 10: 80,223,091 (GRCm39) D55G Het
Mrps27 A T 13: 99,547,788 (GRCm39) K233* probably null Het
Myo1f A G 17: 33,798,902 (GRCm39) N189S probably damaging Het
Nbn A T 4: 15,991,190 (GRCm39) K729N probably benign Het
Or1e35 T C 11: 73,798,058 (GRCm39) S87G probably benign Het
Or8k35 C A 2: 86,424,498 (GRCm39) V225F possibly damaging Het
Pgghg T C 7: 140,525,633 (GRCm39) S479P Het
Plaat5 A G 19: 7,591,946 (GRCm39) T121A probably benign Het
Polr1e A C 4: 45,029,340 (GRCm39) H315P probably damaging Het
Pou6f2 A G 13: 18,299,874 (GRCm39) V595A Het
Prdm15 T C 16: 97,596,941 (GRCm39) D960G possibly damaging Het
Prkcz A T 4: 155,353,516 (GRCm39) M460K probably benign Het
Prkd2 G T 7: 16,591,730 (GRCm39) R587L probably benign Het
Prkn C A 17: 12,073,748 (GRCm39) N355K possibly damaging Het
Rabep1 C A 11: 70,830,815 (GRCm39) T829N probably damaging Het
Rptn A G 3: 93,303,261 (GRCm39) E198G probably benign Het
Ryr2 A T 13: 11,680,799 (GRCm39) I3182N possibly damaging Het
Sectm1a T A 11: 120,960,708 (GRCm39) I36F possibly damaging Het
Sez6l T C 5: 112,621,346 (GRCm39) S243G probably benign Het
Spata31h1 T C 10: 82,122,876 (GRCm39) E3378G probably benign Het
Taf2 T A 15: 54,925,537 (GRCm39) H235L probably benign Het
Tbc1d7 T C 13: 43,306,493 (GRCm39) Q161R probably benign Het
Tfcp2 T C 15: 100,416,468 (GRCm39) T271A possibly damaging Het
Thrsp G T 7: 97,066,295 (GRCm39) T139K probably damaging Het
Timm10 T A 2: 84,660,333 (GRCm39) *91R probably null Het
Tlr11 T A 14: 50,599,598 (GRCm39) I528N possibly damaging Het
Tnnt2 T A 1: 135,779,444 (GRCm39) L278Q probably damaging Het
Toe1 A T 4: 116,664,715 (GRCm39) M1K probably null Het
Trpv5 G A 6: 41,652,242 (GRCm39) R148* probably null Het
Ttll13 A C 7: 79,903,911 (GRCm39) K280Q probably damaging Het
Ttn A G 2: 76,783,550 (GRCm39) V860A unknown Het
Txnip T C 3: 96,466,991 (GRCm39) Y222H probably damaging Het
Ubr4 G A 4: 139,170,725 (GRCm39) S1600N probably damaging Het
Uhrf1 T C 17: 56,622,193 (GRCm39) Y364H probably damaging Het
Unc5a A T 13: 55,138,833 (GRCm39) T71S probably damaging Het
Vmn1r123 A T 7: 20,896,537 (GRCm39) Y143F possibly damaging Het
Vmn1r180 T A 7: 23,651,891 (GRCm39) I18N probably damaging Het
Washc2 A G 6: 116,185,168 (GRCm39) M1V probably null Het
Zfp174 C A 16: 3,666,111 (GRCm39) H125Q probably benign Het
Zfpl1 T C 19: 6,131,943 (GRCm39) H227R possibly damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 8,984,587 (GRCm39) missense probably damaging 0.99
IGL00509:Ahnak APN 19 8,987,315 (GRCm39) missense possibly damaging 0.94
IGL00539:Ahnak APN 19 8,985,272 (GRCm39) missense possibly damaging 0.50
IGL00558:Ahnak APN 19 8,981,671 (GRCm39) missense possibly damaging 0.93
IGL00567:Ahnak APN 19 8,990,747 (GRCm39) missense probably benign 0.24
IGL00706:Ahnak APN 19 8,991,094 (GRCm39) nonsense probably null
IGL00807:Ahnak APN 19 8,985,886 (GRCm39) missense possibly damaging 0.92
IGL00870:Ahnak APN 19 8,991,062 (GRCm39) missense probably damaging 1.00
IGL01101:Ahnak APN 19 8,990,251 (GRCm39) intron probably benign
IGL01118:Ahnak APN 19 8,989,942 (GRCm39) missense probably damaging 1.00
IGL01288:Ahnak APN 19 8,979,858 (GRCm39) missense possibly damaging 0.94
IGL01324:Ahnak APN 19 8,980,396 (GRCm39) missense probably damaging 1.00
IGL01341:Ahnak APN 19 8,989,067 (GRCm39) missense probably benign
IGL01541:Ahnak APN 19 8,985,243 (GRCm39) missense possibly damaging 0.95
IGL01580:Ahnak APN 19 8,980,203 (GRCm39) missense probably benign 0.02
IGL01595:Ahnak APN 19 8,980,865 (GRCm39) nonsense probably null
IGL01746:Ahnak APN 19 8,982,276 (GRCm39) missense possibly damaging 0.89
IGL01766:Ahnak APN 19 8,977,482 (GRCm39) missense unknown
IGL01821:Ahnak APN 19 8,989,482 (GRCm39) missense probably benign
IGL01913:Ahnak APN 19 8,983,428 (GRCm39) nonsense probably null
IGL01934:Ahnak APN 19 8,980,021 (GRCm39) missense probably damaging 1.00
IGL01940:Ahnak APN 19 8,983,921 (GRCm39) missense probably benign 0.14
IGL01958:Ahnak APN 19 8,992,273 (GRCm39) missense possibly damaging 0.59
IGL02145:Ahnak APN 19 8,980,219 (GRCm39) missense probably benign 0.11
IGL02246:Ahnak APN 19 8,985,632 (GRCm39) missense probably damaging 1.00
IGL02282:Ahnak APN 19 8,983,351 (GRCm39) missense probably damaging 1.00
IGL02428:Ahnak APN 19 8,992,197 (GRCm39) missense possibly damaging 0.83
IGL02442:Ahnak APN 19 8,981,380 (GRCm39) missense probably damaging 1.00
IGL02474:Ahnak APN 19 8,982,297 (GRCm39) missense probably benign 0.13
IGL02483:Ahnak APN 19 8,980,672 (GRCm39) missense probably benign 0.01
IGL02616:Ahnak APN 19 8,982,991 (GRCm39) missense probably benign 0.03
IGL02630:Ahnak APN 19 8,989,441 (GRCm39) missense probably damaging 1.00
IGL02690:Ahnak APN 19 8,989,948 (GRCm39) nonsense probably null
IGL02717:Ahnak APN 19 8,979,751 (GRCm39) missense probably benign 0.00
IGL02721:Ahnak APN 19 8,987,071 (GRCm39) missense probably benign 0.07
IGL02737:Ahnak APN 19 8,981,957 (GRCm39) missense probably benign 0.17
IGL02850:Ahnak APN 19 8,979,960 (GRCm39) missense probably benign 0.00
IGL03071:Ahnak APN 19 8,989,282 (GRCm39) missense possibly damaging 0.63
IGL03072:Ahnak APN 19 8,983,872 (GRCm39) missense probably benign 0.11
IGL03094:Ahnak APN 19 8,980,911 (GRCm39) missense possibly damaging 0.64
IGL03140:Ahnak APN 19 8,982,576 (GRCm39) intron probably benign
IGL03176:Ahnak APN 19 8,979,813 (GRCm39) missense probably damaging 1.00
IGL03176:Ahnak APN 19 8,985,530 (GRCm39) missense possibly damaging 0.56
IGL03189:Ahnak APN 19 8,988,603 (GRCm39) missense possibly damaging 0.65
IGL03357:Ahnak APN 19 8,986,689 (GRCm39) intron probably benign
IGL03371:Ahnak APN 19 8,981,592 (GRCm39) missense possibly damaging 0.91
Eskimo UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
Nanook UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
Netsilik UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
IGL03097:Ahnak UTSW 19 8,979,751 (GRCm39) missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 8,983,540 (GRCm39) missense possibly damaging 0.87
R0054:Ahnak UTSW 19 8,989,420 (GRCm39) missense probably damaging 1.00
R0094:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R0110:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0141:Ahnak UTSW 19 8,984,044 (GRCm39) missense probably damaging 1.00
R0166:Ahnak UTSW 19 8,983,089 (GRCm39) missense probably damaging 1.00
R0309:Ahnak UTSW 19 8,979,859 (GRCm39) missense probably damaging 1.00
R0368:Ahnak UTSW 19 8,985,714 (GRCm39) nonsense probably null
R0386:Ahnak UTSW 19 8,988,508 (GRCm39) missense possibly damaging 0.94
R0401:Ahnak UTSW 19 8,992,480 (GRCm39) missense probably benign 0.24
R0415:Ahnak UTSW 19 8,990,235 (GRCm39) intron probably benign
R0463:Ahnak UTSW 19 8,986,771 (GRCm39) intron probably benign
R0469:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0470:Ahnak UTSW 19 8,986,331 (GRCm39) missense probably benign 0.29
R0487:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R0487:Ahnak UTSW 19 8,984,515 (GRCm39) missense probably benign 0.00
R0499:Ahnak UTSW 19 8,977,628 (GRCm39) splice site probably benign
R0506:Ahnak UTSW 19 8,986,492 (GRCm39) missense probably damaging 1.00
R0510:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0557:Ahnak UTSW 19 8,979,308 (GRCm39) missense probably benign 0.10
R0570:Ahnak UTSW 19 8,991,062 (GRCm39) missense probably damaging 1.00
R0610:Ahnak UTSW 19 8,985,242 (GRCm39) missense probably benign 0.08
R0646:Ahnak UTSW 19 8,990,766 (GRCm39) nonsense probably null
R0659:Ahnak UTSW 19 8,992,366 (GRCm39) missense possibly damaging 0.60
R0791:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0792:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0840:Ahnak UTSW 19 8,982,427 (GRCm39) missense probably damaging 1.00
R0847:Ahnak UTSW 19 8,983,797 (GRCm39) nonsense probably null
R0941:Ahnak UTSW 19 8,987,278 (GRCm39) missense probably damaging 1.00
R0962:Ahnak UTSW 19 8,990,212 (GRCm39) intron probably benign
R1017:Ahnak UTSW 19 8,987,907 (GRCm39) missense probably damaging 0.99
R1037:Ahnak UTSW 19 8,984,982 (GRCm39) missense probably benign 0.27
R1085:Ahnak UTSW 19 8,990,489 (GRCm39) missense possibly damaging 0.50
R1113:Ahnak UTSW 19 8,982,984 (GRCm39) missense probably benign 0.29
R1140:Ahnak UTSW 19 8,981,609 (GRCm39) missense probably damaging 1.00
R1158:Ahnak UTSW 19 8,991,290 (GRCm39) missense probably benign 0.00
R1218:Ahnak UTSW 19 8,992,983 (GRCm39) missense probably damaging 1.00
R1225:Ahnak UTSW 19 8,980,247 (GRCm39) missense probably damaging 1.00
R1245:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R1421:Ahnak UTSW 19 8,992,995 (GRCm39) missense possibly damaging 0.95
R1447:Ahnak UTSW 19 8,984,446 (GRCm39) missense probably damaging 0.98
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1471:Ahnak UTSW 19 8,990,296 (GRCm39) intron probably benign
R1507:Ahnak UTSW 19 8,987,441 (GRCm39) missense probably damaging 1.00
R1521:Ahnak UTSW 19 8,982,092 (GRCm39) missense probably benign 0.11
R1568:Ahnak UTSW 19 8,979,739 (GRCm39) missense probably damaging 0.98
R1569:Ahnak UTSW 19 8,981,458 (GRCm39) missense possibly damaging 0.78
R1616:Ahnak UTSW 19 8,986,351 (GRCm39) missense possibly damaging 0.94
R1638:Ahnak UTSW 19 8,986,813 (GRCm39) missense probably benign 0.01
R1680:Ahnak UTSW 19 8,987,327 (GRCm39) missense probably benign 0.05
R1713:Ahnak UTSW 19 8,989,173 (GRCm39) missense possibly damaging 0.95
R1722:Ahnak UTSW 19 8,988,019 (GRCm39) missense probably damaging 0.99
R1771:Ahnak UTSW 19 8,991,117 (GRCm39) missense probably benign 0.24
R1795:Ahnak UTSW 19 8,979,802 (GRCm39) missense possibly damaging 0.79
R1823:Ahnak UTSW 19 8,982,269 (GRCm39) missense probably damaging 0.99
R1842:Ahnak UTSW 19 8,983,231 (GRCm39) missense probably damaging 0.99
R1854:Ahnak UTSW 19 8,991,196 (GRCm39) missense possibly damaging 0.61
R1856:Ahnak UTSW 19 8,979,412 (GRCm39) missense possibly damaging 0.86
R1886:Ahnak UTSW 19 8,993,343 (GRCm39) missense probably damaging 0.98
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1912:Ahnak UTSW 19 8,995,245 (GRCm39) missense probably damaging 1.00
R1913:Ahnak UTSW 19 8,985,286 (GRCm39) missense probably damaging 0.99
R1942:Ahnak UTSW 19 8,992,447 (GRCm39) missense probably damaging 0.98
R1987:Ahnak UTSW 19 8,992,615 (GRCm39) missense probably damaging 1.00
R2006:Ahnak UTSW 19 8,984,439 (GRCm39) missense probably damaging 1.00
R2013:Ahnak UTSW 19 8,991,937 (GRCm39) missense probably damaging 0.98
R2014:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R2047:Ahnak UTSW 19 8,991,664 (GRCm39) missense possibly damaging 0.67
R2048:Ahnak UTSW 19 8,984,420 (GRCm39) missense probably damaging 0.99
R2060:Ahnak UTSW 19 8,985,405 (GRCm39) missense probably benign 0.08
R2083:Ahnak UTSW 19 8,988,921 (GRCm39) missense probably damaging 1.00
R2157:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R2167:Ahnak UTSW 19 8,988,858 (GRCm39) nonsense probably null
R2208:Ahnak UTSW 19 8,995,096 (GRCm39) missense probably benign 0.00
R2224:Ahnak UTSW 19 8,990,355 (GRCm39) intron probably benign
R2268:Ahnak UTSW 19 8,987,938 (GRCm39) missense possibly damaging 0.66
R2420:Ahnak UTSW 19 8,986,620 (GRCm39) missense possibly damaging 0.89
R2426:Ahnak UTSW 19 8,980,215 (GRCm39) missense possibly damaging 0.81
R2910:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2911:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2981:Ahnak UTSW 19 8,977,512 (GRCm39) missense probably damaging 0.97
R3151:Ahnak UTSW 19 8,987,308 (GRCm39) missense probably benign 0.12
R3155:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R3422:Ahnak UTSW 19 8,984,116 (GRCm39) missense probably benign 0.05
R3422:Ahnak UTSW 19 8,983,072 (GRCm39) missense probably benign 0.39
R3430:Ahnak UTSW 19 8,984,322 (GRCm39) missense probably benign 0.42
R3433:Ahnak UTSW 19 8,987,358 (GRCm39) missense probably benign 0.01
R3711:Ahnak UTSW 19 8,985,262 (GRCm39) missense probably benign
R3723:Ahnak UTSW 19 8,994,217 (GRCm39) missense possibly damaging 0.79
R3775:Ahnak UTSW 19 8,986,387 (GRCm39) missense possibly damaging 0.91
R3858:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3859:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3922:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3924:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3926:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R4026:Ahnak UTSW 19 8,988,663 (GRCm39) missense probably damaging 0.97
R4051:Ahnak UTSW 19 8,991,691 (GRCm39) missense probably damaging 1.00
R4209:Ahnak UTSW 19 8,979,964 (GRCm39) missense probably damaging 1.00
R4234:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R4237:Ahnak UTSW 19 8,979,147 (GRCm39) missense probably benign 0.02
R4285:Ahnak UTSW 19 8,994,203 (GRCm39) nonsense probably null
R4331:Ahnak UTSW 19 8,993,184 (GRCm39) missense probably damaging 1.00
R4342:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R4430:Ahnak UTSW 19 8,980,404 (GRCm39) missense probably benign 0.00
R4554:Ahnak UTSW 19 8,992,294 (GRCm39) missense probably damaging 1.00
R4602:Ahnak UTSW 19 8,988,189 (GRCm39) missense possibly damaging 0.66
R4612:Ahnak UTSW 19 8,981,088 (GRCm39) missense probably benign 0.44
R4655:Ahnak UTSW 19 8,986,065 (GRCm39) missense probably damaging 1.00
R4656:Ahnak UTSW 19 8,982,219 (GRCm39) missense possibly damaging 0.80
R4700:Ahnak UTSW 19 8,982,045 (GRCm39) missense probably benign 0.02
R4704:Ahnak UTSW 19 8,989,622 (GRCm39) intron probably benign
R4704:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R4705:Ahnak UTSW 19 8,994,270 (GRCm39) missense probably benign 0.07
R4707:Ahnak UTSW 19 8,994,099 (GRCm39) missense probably benign 0.03
R4732:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4733:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4778:Ahnak UTSW 19 8,989,339 (GRCm39) missense possibly damaging 0.79
R4782:Ahnak UTSW 19 8,989,863 (GRCm39) intron probably benign
R4832:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R4882:Ahnak UTSW 19 8,983,261 (GRCm39) missense probably damaging 0.98
R4884:Ahnak UTSW 19 8,990,118 (GRCm39) intron probably benign
R4895:Ahnak UTSW 19 8,994,805 (GRCm39) missense probably benign 0.43
R4930:Ahnak UTSW 19 8,988,331 (GRCm39) missense possibly damaging 0.79
R4951:Ahnak UTSW 19 8,995,199 (GRCm39) missense probably damaging 1.00
R4968:Ahnak UTSW 19 8,992,464 (GRCm39) missense probably damaging 1.00
R5026:Ahnak UTSW 19 8,987,995 (GRCm39) missense possibly damaging 0.46
R5050:Ahnak UTSW 19 8,989,822 (GRCm39) intron probably benign
R5073:Ahnak UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
R5110:Ahnak UTSW 19 8,992,123 (GRCm39) missense probably damaging 1.00
R5119:Ahnak UTSW 19 8,991,008 (GRCm39) missense probably benign 0.00
R5128:Ahnak UTSW 19 8,994,451 (GRCm39) missense probably damaging 1.00
R5139:Ahnak UTSW 19 8,982,019 (GRCm39) missense probably damaging 1.00
R5150:Ahnak UTSW 19 8,988,268 (GRCm39) missense possibly damaging 0.46
R5151:Ahnak UTSW 19 8,994,933 (GRCm39) missense probably benign 0.03
R5165:Ahnak UTSW 19 8,993,029 (GRCm39) missense possibly damaging 0.95
R5236:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R5361:Ahnak UTSW 19 8,992,705 (GRCm39) missense possibly damaging 0.92
R5366:Ahnak UTSW 19 8,994,099 (GRCm39) missense possibly damaging 0.65
R5387:Ahnak UTSW 19 8,981,055 (GRCm39) missense probably damaging 1.00
R5396:Ahnak UTSW 19 8,984,539 (GRCm39) missense probably damaging 0.99
R5583:Ahnak UTSW 19 8,984,281 (GRCm39) missense probably damaging 0.99
R5587:Ahnak UTSW 19 8,986,840 (GRCm39) missense possibly damaging 0.88
R5620:Ahnak UTSW 19 8,990,458 (GRCm39) nonsense probably null
R5643:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5644:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5657:Ahnak UTSW 19 8,991,979 (GRCm39) missense probably damaging 0.99
R5688:Ahnak UTSW 19 8,979,883 (GRCm39) missense probably benign 0.01
R5702:Ahnak UTSW 19 8,979,204 (GRCm39) missense probably damaging 1.00
R5727:Ahnak UTSW 19 8,994,111 (GRCm39) missense probably damaging 0.99
R5730:Ahnak UTSW 19 8,987,617 (GRCm39) missense possibly damaging 0.81
R5755:Ahnak UTSW 19 8,979,096 (GRCm39) missense probably benign 0.06
R5760:Ahnak UTSW 19 8,990,926 (GRCm39) missense probably damaging 1.00
R5789:Ahnak UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
R5790:Ahnak UTSW 19 8,992,612 (GRCm39) missense probably damaging 0.99
R5795:Ahnak UTSW 19 8,989,746 (GRCm39) nonsense probably null
R5808:Ahnak UTSW 19 8,987,599 (GRCm39) missense possibly damaging 0.91
R5867:Ahnak UTSW 19 8,987,416 (GRCm39) missense probably damaging 0.99
R5878:Ahnak UTSW 19 8,985,706 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,995,575 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,991,131 (GRCm39) missense possibly damaging 0.63
R5912:Ahnak UTSW 19 8,989,267 (GRCm39) missense probably damaging 0.99
R5935:Ahnak UTSW 19 8,992,546 (GRCm39) missense possibly damaging 0.91
R5969:Ahnak UTSW 19 8,993,949 (GRCm39) missense probably damaging 1.00
R5988:Ahnak UTSW 19 8,986,711 (GRCm39) intron probably benign
R6000:Ahnak UTSW 19 8,990,475 (GRCm39) nonsense probably null
R6005:Ahnak UTSW 19 8,992,525 (GRCm39) missense possibly damaging 0.61
R6101:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6105:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6116:Ahnak UTSW 19 8,990,327 (GRCm39) intron probably benign
R6209:Ahnak UTSW 19 8,989,930 (GRCm39) missense probably damaging 1.00
R6240:Ahnak UTSW 19 8,990,947 (GRCm39) missense probably damaging 1.00
R6255:Ahnak UTSW 19 8,985,389 (GRCm39) missense possibly damaging 0.95
R6263:Ahnak UTSW 19 8,995,641 (GRCm39) missense probably benign 0.03
R6287:Ahnak UTSW 19 8,992,367 (GRCm39) missense probably benign 0.02
R6296:Ahnak UTSW 19 8,980,669 (GRCm39) missense probably damaging 0.99
R6315:Ahnak UTSW 19 8,983,990 (GRCm39) missense probably damaging 0.99
R6328:Ahnak UTSW 19 8,984,512 (GRCm39) missense probably benign 0.11
R6331:Ahnak UTSW 19 8,983,989 (GRCm39) missense probably benign 0.18
R6355:Ahnak UTSW 19 8,986,126 (GRCm39) missense probably benign 0.02
R6409:Ahnak UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
R6567:Ahnak UTSW 19 8,986,170 (GRCm39) missense probably benign 0.27
R6572:Ahnak UTSW 19 8,985,340 (GRCm39) missense probably damaging 0.99
R6574:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R6590:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6620:Ahnak UTSW 19 8,992,674 (GRCm39) missense possibly damaging 0.95
R6690:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6731:Ahnak UTSW 19 8,988,926 (GRCm39) missense possibly damaging 0.85
R6756:Ahnak UTSW 19 8,984,925 (GRCm39) missense possibly damaging 0.59
R6846:Ahnak UTSW 19 8,989,221 (GRCm39) missense possibly damaging 0.66
R6854:Ahnak UTSW 19 8,992,599 (GRCm39) missense probably damaging 1.00
R6857:Ahnak UTSW 19 9,014,532 (GRCm39) nonsense probably null
R6863:Ahnak UTSW 19 8,989,729 (GRCm39) intron probably benign
R6876:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R6958:Ahnak UTSW 19 8,992,579 (GRCm39) missense possibly damaging 0.88
R7126:Ahnak UTSW 19 8,979,723 (GRCm39) missense possibly damaging 0.61
R7181:Ahnak UTSW 19 8,990,852 (GRCm39) missense probably damaging 1.00
R7183:Ahnak UTSW 19 8,995,032 (GRCm39) missense probably damaging 1.00
R7202:Ahnak UTSW 19 8,995,163 (GRCm39) missense probably damaging 1.00
R7235:Ahnak UTSW 19 8,989,852 (GRCm39) missense unknown
R7269:Ahnak UTSW 19 8,983,981 (GRCm39) missense probably damaging 1.00
R7311:Ahnak UTSW 19 8,979,507 (GRCm39) missense probably benign 0.04
R7311:Ahnak UTSW 19 8,987,191 (GRCm39) missense possibly damaging 0.56
R7329:Ahnak UTSW 19 8,979,156 (GRCm39) missense probably damaging 0.99
R7339:Ahnak UTSW 19 8,985,529 (GRCm39) missense possibly damaging 0.75
R7390:Ahnak UTSW 19 8,980,569 (GRCm39) missense probably benign 0.02
R7400:Ahnak UTSW 19 8,991,977 (GRCm39) missense probably damaging 0.99
R7444:Ahnak UTSW 19 8,984,787 (GRCm39) missense probably benign 0.08
R7483:Ahnak UTSW 19 8,982,186 (GRCm39) missense probably damaging 1.00
R7498:Ahnak UTSW 19 8,989,383 (GRCm39) missense probably benign 0.14
R7521:Ahnak UTSW 19 8,979,715 (GRCm39) missense possibly damaging 0.89
R7522:Ahnak UTSW 19 8,979,686 (GRCm39) missense probably benign 0.01
R7552:Ahnak UTSW 19 8,984,188 (GRCm39) missense probably benign 0.18
R7563:Ahnak UTSW 19 8,988,529 (GRCm39) missense probably damaging 0.99
R7565:Ahnak UTSW 19 8,993,520 (GRCm39) missense probably benign 0.05
R7571:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R7583:Ahnak UTSW 19 8,983,457 (GRCm39) missense possibly damaging 0.90
R7600:Ahnak UTSW 19 8,981,938 (GRCm39) missense possibly damaging 0.89
R7771:Ahnak UTSW 19 8,992,411 (GRCm39) missense probably damaging 0.99
R7787:Ahnak UTSW 19 8,986,679 (GRCm39) missense unknown
R7827:Ahnak UTSW 19 8,982,708 (GRCm39) nonsense probably null
R7857:Ahnak UTSW 19 8,984,832 (GRCm39) missense probably damaging 0.97
R7916:Ahnak UTSW 19 8,983,196 (GRCm39) missense possibly damaging 0.66
R7939:Ahnak UTSW 19 8,991,448 (GRCm39) nonsense probably null
R7959:Ahnak UTSW 19 8,988,013 (GRCm39) missense possibly damaging 0.46
R7962:Ahnak UTSW 19 8,990,164 (GRCm39) missense unknown
R7979:Ahnak UTSW 19 8,988,796 (GRCm39) missense probably damaging 1.00
R8006:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R8013:Ahnak UTSW 19 8,986,699 (GRCm39) missense unknown
R8033:Ahnak UTSW 19 8,981,074 (GRCm39) missense probably benign 0.10
R8124:Ahnak UTSW 19 8,984,487 (GRCm39) missense probably damaging 0.99
R8125:Ahnak UTSW 19 8,989,240 (GRCm39) missense possibly damaging 0.95
R8129:Ahnak UTSW 19 8,977,464 (GRCm39) start codon destroyed not run
R8151:Ahnak UTSW 19 8,982,043 (GRCm39) missense possibly damaging 0.59
R8190:Ahnak UTSW 19 8,979,619 (GRCm39) missense probably benign 0.01
R8221:Ahnak UTSW 19 8,987,800 (GRCm39) nonsense probably null
R8241:Ahnak UTSW 19 8,984,659 (GRCm39) missense probably benign 0.15
R8244:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8248:Ahnak UTSW 19 8,979,310 (GRCm39) missense probably damaging 1.00
R8261:Ahnak UTSW 19 8,982,817 (GRCm39) missense probably damaging 1.00
R8330:Ahnak UTSW 19 8,987,026 (GRCm39) missense possibly damaging 0.86
R8380:Ahnak UTSW 19 8,995,219 (GRCm39) missense probably benign 0.05
R8407:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8409:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8463:Ahnak UTSW 19 8,986,113 (GRCm39) missense probably benign 0.07
R8511:Ahnak UTSW 19 8,989,719 (GRCm39) missense unknown
R8528:Ahnak UTSW 19 8,985,092 (GRCm39) missense probably damaging 1.00
R8549:Ahnak UTSW 19 8,988,847 (GRCm39) missense probably damaging 1.00
R8674:Ahnak UTSW 19 8,983,360 (GRCm39) missense probably damaging 0.98
R8716:Ahnak UTSW 19 8,986,438 (GRCm39) missense probably damaging 1.00
R8722:Ahnak UTSW 19 8,990,710 (GRCm39) nonsense probably null
R8751:Ahnak UTSW 19 8,987,509 (GRCm39) missense probably damaging 1.00
R8752:Ahnak UTSW 19 8,992,901 (GRCm39) missense probably damaging 1.00
R8783:Ahnak UTSW 19 8,988,837 (GRCm39) missense probably damaging 1.00
R8844:Ahnak UTSW 19 8,984,254 (GRCm39) missense probably damaging 1.00
R8859:Ahnak UTSW 19 8,984,567 (GRCm39) missense probably damaging 1.00
R8882:Ahnak UTSW 19 8,978,106 (GRCm39) missense probably damaging 1.00
R8907:Ahnak UTSW 19 8,986,452 (GRCm39) missense probably benign 0.24
R8938:Ahnak UTSW 19 8,989,099 (GRCm39) missense probably benign 0.00
R8975:Ahnak UTSW 19 8,990,101 (GRCm39) missense probably damaging 1.00
R8983:Ahnak UTSW 19 8,981,477 (GRCm39) missense possibly damaging 0.75
R9017:Ahnak UTSW 19 8,987,487 (GRCm39) missense probably damaging 1.00
R9027:Ahnak UTSW 19 8,984,617 (GRCm39) missense possibly damaging 0.94
R9081:Ahnak UTSW 19 8,985,890 (GRCm39) missense possibly damaging 0.81
R9104:Ahnak UTSW 19 8,987,711 (GRCm39) missense probably benign 0.01
R9112:Ahnak UTSW 19 8,987,149 (GRCm39) missense probably damaging 0.98
R9145:Ahnak UTSW 19 8,992,287 (GRCm39) missense probably benign 0.38
R9189:Ahnak UTSW 19 8,988,247 (GRCm39) missense possibly damaging 0.92
R9221:Ahnak UTSW 19 8,989,943 (GRCm39) missense probably damaging 1.00
R9261:Ahnak UTSW 19 8,993,503 (GRCm39) missense possibly damaging 0.63
R9299:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9325:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R9337:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9340:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R9351:Ahnak UTSW 19 8,985,232 (GRCm39) missense probably damaging 1.00
R9416:Ahnak UTSW 19 8,990,266 (GRCm39) missense unknown
R9462:Ahnak UTSW 19 8,981,299 (GRCm39) missense probably damaging 0.96
R9469:Ahnak UTSW 19 8,988,225 (GRCm39) missense probably damaging 1.00
R9485:Ahnak UTSW 19 8,979,438 (GRCm39) missense probably benign 0.16
R9503:Ahnak UTSW 19 8,987,458 (GRCm39) missense probably damaging 1.00
R9524:Ahnak UTSW 19 9,014,617 (GRCm39) missense
R9534:Ahnak UTSW 19 8,980,976 (GRCm39) missense probably benign 0.20
R9598:Ahnak UTSW 19 8,981,149 (GRCm39) missense probably benign 0.42
R9611:Ahnak UTSW 19 8,989,162 (GRCm39) missense probably damaging 0.99
R9624:Ahnak UTSW 19 8,989,846 (GRCm39) missense unknown
R9649:Ahnak UTSW 19 8,985,786 (GRCm39) nonsense probably null
R9683:Ahnak UTSW 19 8,984,719 (GRCm39) missense possibly damaging 0.94
R9691:Ahnak UTSW 19 8,989,090 (GRCm39) missense possibly damaging 0.49
R9712:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9712:Ahnak UTSW 19 8,984,392 (GRCm39) small deletion probably benign
R9713:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9715:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9725:Ahnak UTSW 19 8,991,607 (GRCm39) missense probably damaging 1.00
R9725:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R9747:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R9798:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
RF007:Ahnak UTSW 19 8,990,965 (GRCm39) missense possibly damaging 0.45
X0021:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
X0027:Ahnak UTSW 19 8,989,401 (GRCm39) missense probably damaging 1.00
Z1088:Ahnak UTSW 19 8,993,446 (GRCm39) missense probably damaging 0.99
Z1176:Ahnak UTSW 19 8,986,220 (GRCm39) missense probably damaging 0.97
Z1177:Ahnak UTSW 19 8,994,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGCCCAAGTTCAGCATG -3'
(R):5'- AGCCAGGCATGCTGAACTTG -3'

Sequencing Primer
(F):5'- TCAGCATGCCTGGCTTCAAAG -3'
(R):5'- CATCTTCAGGTGCCAGTCTGG -3'
Posted On 2019-06-26