Mutagenetix > Incidental Mutations

Incidental Mutation 'R0578:Atad2'

56327

Institutional Source

Beutler Lab

Gene Symbol

Atad2

Ensembl Gene

ENSMUSG00000022360

Gene Name

ATPase family, AAA domain containing 2

Synonyms

2610509G12Rik

MMRRC Submission

038768-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.336) question?

Stock #

R0578 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58094044-58135082 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58105568 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 525 (T525I)

Ref Sequence

ENSEMBL: ENSMUSP00000153936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038194
AA Change: T849I

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: T849I

Domain	Start	End	E-Value	Type
low complexity region	12	35	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	184	199	N/A	INTRINSIC
low complexity region	237	268	N/A	INTRINSIC
low complexity region	337	349	N/A	INTRINSIC
AAA	438	579	9.93e-21	SMART
low complexity region	622	633	N/A	INTRINSIC
SCOP:d1e32a2	751	912	5e-4	SMART
low complexity region	924	947	N/A	INTRINSIC
BROMO	955	1067	1.2e-19	SMART
low complexity region	1213	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226526

Predicted Effect

probably damaging
Transcript: ENSMUST00000228783
AA Change: T525I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.2052

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,059,355	Y56C	possibly damaging	Het
Abca5	A	T	11: 110,276,489	C1500*	probably null	Het
Acr	C	G	15: 89,569,475	H72Q	probably damaging	Het
Adam18	T	C	8: 24,641,847	D416G	possibly damaging	Het
Afap1l2	T	A	19: 56,915,782	Y691F	probably benign	Het
Akna	A	G	4: 63,370,910	S1259P	probably benign	Het
Atp2a1	T	G	7: 126,450,143	M576L	probably benign	Het
B4galt6	T	C	18: 20,727,956		probably benign	Het
Best3	A	G	10: 117,008,999	D353G	probably benign	Het
Btg3	A	T	16: 78,364,946	D125E	probably benign	Het
C87499	T	A	4: 88,634,139	I2F	probably benign	Het
Cabin1	A	T	10: 75,713,610	D1320E	probably damaging	Het
Cachd1	A	C	4: 100,994,842		probably benign	Het
Cad	T	C	5: 31,058,776	V151A	probably benign	Het
Capns1	A	T	7: 30,194,028		probably benign	Het
Catsperg2	T	A	7: 29,704,691	T860S	possibly damaging	Het
Ccdc61	T	C	7: 18,903,475	T76A	probably benign	Het
Cdipt	T	A	7: 126,979,530		probably null	Het
Cyp2d12	G	A	15: 82,556,383		probably benign	Het
Dennd4c	C	A	4: 86,812,422	P852Q	probably damaging	Het
Dsg2	G	A	18: 20,594,234	V613I	probably benign	Het
Dusp16	G	C	6: 134,718,321	L516V	probably damaging	Het
Eif2ak4	T	G	2: 118,474,991		probably benign	Het
Faf2	C	T	13: 54,621,845	A2V	possibly damaging	Het
Gas2l3	A	G	10: 89,417,075	I236T	probably damaging	Het
Gm6605	C	A	7: 38,448,275		noncoding transcript	Het
Got1	G	T	19: 43,515,783	S66R	probably benign	Het
Gpr149	T	A	3: 62,602,689	H335L	possibly damaging	Het
Hadhb	A	G	5: 30,178,806	I342M	probably benign	Het
Helz	T	A	11: 107,686,400	V1859D	unknown	Het
Htr1a	T	A	13: 105,445,087	N278K	probably damaging	Het
Inppl1	T	C	7: 101,831,588	E355G	probably damaging	Het
Isl2	A	G	9: 55,545,035	Y297C	probably damaging	Het
Kat7	T	C	11: 95,291,524	H250R	probably benign	Het
Klhl30	A	T	1: 91,354,352	D225V	probably benign	Het
Mtch2	T	C	2: 90,852,830		probably benign	Het
Muc4	C	A	16: 32,755,690		probably benign	Het
Ncoa7	A	C	10: 30,701,917		probably null	Het
Nuf2	T	A	1: 169,510,549		probably benign	Het
Olfr767	A	G	10: 129,079,193	Y257H	probably damaging	Het
Olfr994	T	C	2: 85,430,673	D52G	probably benign	Het
Pced1a	T	A	2: 130,419,843	S297C	probably damaging	Het
Pi15	A	T	1: 17,602,849	K91*	probably null	Het
Pla2g4e	C	T	2: 120,244,681		probably benign	Het
Plce1	A	T	19: 38,777,939	H2136L	probably damaging	Het
Plec	A	G	15: 76,176,884	L2973P	probably damaging	Het
Poln	A	G	5: 34,014,338	I695T	probably damaging	Het
R3hdm1	C	T	1: 128,231,437	Q950*	probably null	Het
Rxra	C	T	2: 27,759,570	A429V	probably damaging	Het
Scnn1a	G	A	6: 125,322,244	G96S	probably damaging	Het
Senp5	T	A	16: 31,989,345	T337S	possibly damaging	Het
Smg9	A	G	7: 24,415,043	D269G	probably damaging	Het
Srsf11	C	T	3: 158,012,067		probably benign	Het
Tmtc1	C	T	6: 148,355,218		probably benign	Het
Vmn2r19	T	C	6: 123,335,972	V667A	probably damaging	Het

Other mutations in Atad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Atad2	APN	15	58116820	missense	probably damaging	1.00
IGL00556:Atad2	APN	15	58100080	missense	probably damaging	1.00
IGL00674:Atad2	APN	15	58108386	missense	possibly damaging	0.49
IGL01407:Atad2	APN	15	58104525	missense	probably benign
IGL02557:Atad2	APN	15	58122597	missense	probably benign	0.04
IGL03060:Atad2	APN	15	58122446	unclassified	probably benign
IGL03308:Atad2	APN	15	58102523	missense	probably benign	0.00
R0113:Atad2	UTSW	15	58120934	unclassified	probably benign
R0195:Atad2	UTSW	15	58099954	splice site	probably benign
R0310:Atad2	UTSW	15	58114257	missense	probably damaging	1.00
R0499:Atad2	UTSW	15	58103240	missense	possibly damaging	0.92
R0499:Atad2	UTSW	15	58120949	missense	probably benign
R0564:Atad2	UTSW	15	58125833	splice site	probably benign
R0581:Atad2	UTSW	15	58126664	missense	probably benign
R0667:Atad2	UTSW	15	58098719	missense	probably benign	0.01
R0697:Atad2	UTSW	15	58105543	missense	possibly damaging	0.91
R1219:Atad2	UTSW	15	58134911	missense	probably benign	0.00
R1271:Atad2	UTSW	15	58126589	missense	probably benign	0.00
R1544:Atad2	UTSW	15	58103364	missense	probably damaging	1.00
R1624:Atad2	UTSW	15	58100019	missense	probably damaging	1.00
R1853:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1854:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1855:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1860:Atad2	UTSW	15	58096718	splice site	probably null
R1861:Atad2	UTSW	15	58096718	splice site	probably null
R1876:Atad2	UTSW	15	58106868	missense	probably benign	0.00
R1938:Atad2	UTSW	15	58096705	missense	possibly damaging	0.76
R2158:Atad2	UTSW	15	58098566	missense	possibly damaging	0.95
R3756:Atad2	UTSW	15	58099723	missense	probably benign	0.01
R4256:Atad2	UTSW	15	58116856	missense	probably damaging	1.00
R4762:Atad2	UTSW	15	58108362	missense	probably benign
R4827:Atad2	UTSW	15	58108348	missense	probably benign	0.07
R4838:Atad2	UTSW	15	58103283	missense	probably damaging	1.00
R5238:Atad2	UTSW	15	58108337	missense	possibly damaging	0.90
R5247:Atad2	UTSW	15	58104478	nonsense	probably null
R5685:Atad2	UTSW	15	58116798	missense	possibly damaging	0.95
R5790:Atad2	UTSW	15	58126594	missense	probably damaging	1.00
R5813:Atad2	UTSW	15	58099854	missense	probably benign	0.42
R5886:Atad2	UTSW	15	58098514	nonsense	probably null
R5955:Atad2	UTSW	15	58105659	missense	probably benign	0.06
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6111:Atad2	UTSW	15	58108091	missense	probably benign	0.07
R6209:Atad2	UTSW	15	58118415	missense	probably damaging	1.00
R6587:Atad2	UTSW	15	58121048	missense	probably benign	0.03
R6856:Atad2	UTSW	15	58106813	missense	probably damaging	1.00
R7106:Atad2	UTSW	15	58116766	critical splice donor site	probably null
R7178:Atad2	UTSW	15	58117293	missense	probably damaging	1.00
R7290:Atad2	UTSW	15	58098651	missense	probably benign	0.00
R7421:Atad2	UTSW	15	58134926	missense	probably benign	0.40
R7583:Atad2	UTSW	15	58126664	missense	probably benign
R7861:Atad2	UTSW	15	58125780	missense	probably benign	0.10
R7886:Atad2	UTSW	15	58126136	missense	probably damaging	1.00
R7944:Atad2	UTSW	15	58125780	missense	probably benign	0.10
R7969:Atad2	UTSW	15	58126136	missense	probably damaging	1.00
R8072:Atad2	UTSW	15	58099978	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCCCCGTAGCACTTGGTTCTTG -3'
(R):5'- GAGCTGGAGAGATGGCTTAGAGGTT -3'

Sequencing Primer
(F):5'- AGCACTTGGTTCTTGAGGTAG -3'
(R):5'- ttatatttaGCAGCAGAATAGCCTTG -3'

Posted On

2013-07-11