Mutagenetix > Incidental Mutation

Incidental Mutation 'R7242:Zfp423'

563295

Institutional Source

Beutler Lab

Gene Symbol

Zfp423

Ensembl Gene

ENSMUSG00000045333

Gene Name

zinc finger protein 423

Synonyms

Zfp104, ataxia1, Ebfaz, Roaz

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R7242 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87661810-87959595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87904527 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 21 (D21G)

Ref Sequence

ENSEMBL: ENSMUSP00000105282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109655] [ENSMUST00000174764]

AlphaFold

Q80TS5

Predicted Effect

probably benign
Transcript: ENSMUST00000109655
AA Change: D21G

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: D21G

Domain	Start	End	E-Value	Type
low complexity region	60	72	N/A	INTRINSIC
ZnF_C2H2	75	96	5.07e0	SMART
low complexity region	128	144	N/A	INTRINSIC
ZnF_C2H2	146	168	1.28e-3	SMART
ZnF_C2H2	174	196	1.64e-1	SMART
ZnF_C2H2	202	224	2.05e-2	SMART
ZnF_C2H2	230	252	3.21e-4	SMART
ZnF_C2H2	271	294	5.42e-2	SMART
ZnF_C2H2	303	326	1.76e-1	SMART
ZnF_C2H2	331	353	8.67e-1	SMART
low complexity region	371	385	N/A	INTRINSIC
ZnF_C2H2	417	441	1.16e-1	SMART
ZnF_C2H2	449	472	3.52e-1	SMART
ZnF_C2H2	488	511	7.9e-4	SMART
low complexity region	513	524	N/A	INTRINSIC
ZnF_C2H2	525	548	2.53e-2	SMART
ZnF_C2H2	571	596	3.99e0	SMART
low complexity region	612	623	N/A	INTRINSIC
ZnF_C2H2	640	662	3.16e-3	SMART
ZnF_C2H2	670	692	5.81e-2	SMART
ZnF_C2H2	700	723	4.87e-4	SMART
ZnF_C2H2	728	751	7.26e-3	SMART
ZnF_C2H2	758	781	4.79e-3	SMART
ZnF_C2H2	789	811	1.36e-2	SMART
ZnF_C2H2	815	838	4.72e-2	SMART
ZnF_C2H2	894	917	4.12e0	SMART
ZnF_C2H2	938	960	5.59e-4	SMART
ZnF_C2H2	967	989	6.42e-4	SMART
ZnF_C2H2	996	1018	4.94e0	SMART
ZnF_C2H2	1028	1050	4.99e1	SMART
ZnF_C2H2	1128	1151	1.12e-3	SMART
ZnF_C2H2	1176	1198	1.45e-2	SMART
ZnF_C2H2	1206	1228	5.72e-1	SMART
ZnF_C2H2	1237	1260	1.18e-2	SMART
ZnF_C2H2	1267	1290	4.05e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174764
AA Change: D24G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333
AA Change: D24G

Domain	Start	End	E-Value	Type
low complexity region	63	75	N/A	INTRINSIC
ZnF_C2H2	78	99	5.07e0	SMART
low complexity region	131	147	N/A	INTRINSIC
ZnF_C2H2	149	171	1.28e-3	SMART
ZnF_C2H2	177	199	1.64e-1	SMART
ZnF_C2H2	205	227	2.05e-2	SMART
Pfam:zf-C2H2_6	232	244	2.5e-1	PFAM

Meta Mutation Damage Score

0.0983

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,931,128	Y354F	probably damaging	Het
1700001J03Rik	A	T	5: 146,184,867	I74N	probably damaging	Het
4921501E09Rik	A	G	17: 33,067,127	Y234H	probably damaging	Het
Abca6	A	T	11: 110,241,653	V272D	possibly damaging	Het
Acot11	A	T	4: 106,762,493	S163R	probably benign	Het
Adcy5	T	C	16: 35,156,835	L246P	probably damaging	Het
Adgra1	A	T	7: 139,847,657		probably null	Het
Adgra2	A	G	8: 27,122,027	T1335A	probably damaging	Het
Armt1	T	C	10: 4,453,475	S187P	probably damaging	Het
Azin1	T	C	15: 38,501,505	M1V	probably null	Het
B430305J03Rik	C	T	3: 61,363,835	C163Y	unknown	Het
Cables1	T	C	18: 11,840,007	S68P	possibly damaging	Het
Cacna1d	A	G	14: 30,178,706	F341L	probably benign	Het
Ccdc90b	T	A	7: 92,572,568	H118Q	probably damaging	Het
Celf1	T	A	2: 91,003,257	C119*	probably null	Het
Cfap57	C	T	4: 118,593,096	V610M	possibly damaging	Het
Chrm4	T	A	2: 91,927,250	M1K	probably null	Het
Chrnd	C	T	1: 87,197,479	T418I	probably damaging	Het
Coch	G	T	12: 51,593,561		probably benign	Het
Cop1	A	G	1: 159,284,548	T345A	probably benign	Het
Cops6	A	G	5: 138,163,580	T96A	probably benign	Het
Corin	T	C	5: 72,305,055	I945V	probably benign	Het
Cyp2c67	G	T	19: 39,617,339	T371N	probably benign	Het
Dap	T	A	15: 31,273,308	*103R	probably null	Het
Defb35	T	A	8: 21,940,757	V49E	unknown	Het
Dmtf1	T	A	5: 9,149,016	D39V	possibly damaging	Het
Dmtn	T	C	14: 70,618,020	T10A	probably damaging	Het
Dnajc1	C	T	2: 18,293,972	E264K	probably benign	Het
Dtx3l	A	T	16: 35,933,401	N278K	possibly damaging	Het
Fam161a	T	A	11: 23,020,037	S72T	possibly damaging	Het
Fnbp4	T	A	2: 90,745,796	S114T	unknown	Het
Focad	T	G	4: 88,309,906	I784S	unknown	Het
Fzd8	A	T	18: 9,214,171	T418S	probably damaging	Het
Gclc	A	G	9: 77,785,371	Y264C	probably benign	Het
Ggn	G	A	7: 29,173,034	C649Y	possibly damaging	Het
Gm10184	G	A	17: 89,910,135	T61I	probably benign	Het
Gys1	A	G	7: 45,439,668		probably null	Het
Hsd3b1	T	C	3: 98,853,210	Y155C	probably damaging	Het
Htatip2	A	G	7: 49,772,606	K191E	probably benign	Het
Ik	A	T	18: 36,748,222	S79C	probably null	Het
Kin	G	A	2: 10,091,793	R151Q	probably benign	Het
Mast4	A	G	13: 102,738,478	S1461P	probably damaging	Het
Melk	T	A	4: 44,360,885	V555E	probably damaging	Het
Met	G	A	6: 17,491,317	C26Y	probably damaging	Het
Mfsd6	A	T	1: 52,709,474	F77L	probably damaging	Het
Mib1	T	A	18: 10,741,011	D86E	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Olfr1120	G	A	2: 87,358,082	V213I	probably benign	Het
Olfr1352	A	T	10: 78,984,497	K236*	probably null	Het
Olfr504	T	G	7: 108,565,712	S28R	probably benign	Het
Olfr935	A	G	9: 38,995,141	I98T	probably benign	Het
Patj	A	T	4: 98,591,933	I1296L	probably benign	Het
Pcdh1	C	T	18: 38,203,217	V122M	probably benign	Het
Pcdhac2	A	T	18: 37,144,893	I309F	possibly damaging	Het
Phtf1	A	G	3: 103,998,696	S565G	probably damaging	Het
Plekha2	A	C	8: 25,088,395	F30V	probably damaging	Het
Ptbp1	A	G	10: 79,856,388	M20V	unknown	Het
Pth2r	A	G	1: 65,388,620	D484G	probably benign	Het
Rapgef2	G	A	3: 79,087,903	Q665*	probably null	Het
Scamp1	G	A	13: 94,233,140	T59I	probably benign	Het
Sema4a	T	A	3: 88,450,109	D230V	probably damaging	Het
Snw1	C	T	12: 87,468,645	G45R	possibly damaging	Het
Sox30	T	A	11: 45,984,520		probably null	Het
Sspo	T	A	6: 48,473,952	I2665K	probably benign	Het
Stx5a	T	A	19: 8,755,277	W437R	unknown	Het
Tln1	A	G	4: 43,542,602	V1402A	probably benign	Het
Tpm1	A	G	9: 67,028,101	L244P	probably benign	Het
Try5	T	A	6: 41,313,454	E32V	probably benign	Het
Ttn	T	C	2: 76,721,729	N31188S	probably benign	Het
Tulp1	T	C	17: 28,363,405		probably null	Het
Usp13	T	G	3: 32,865,743		probably null	Het
Vax2	A	G	6: 83,711,316	E7G	possibly damaging	Het
Vmn2r45	A	T	7: 8,485,613	Y139*	probably null	Het
Wisp2	T	C	2: 163,828,852	F93S	probably benign	Het

Other mutations in Zfp423

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Zfp423	APN	8	87781611	splice site	probably null
IGL01359:Zfp423	APN	8	87780662	missense	probably damaging	1.00
IGL01780:Zfp423	APN	8	87781508	missense	probably damaging	1.00
IGL02250:Zfp423	APN	8	87783255	missense	probably damaging	1.00
IGL02301:Zfp423	APN	8	87781574	missense	probably damaging	1.00
IGL02320:Zfp423	APN	8	87781602	missense	probably damaging	1.00
IGL02804:Zfp423	APN	8	87782657	missense	probably benign	0.02
IGL03090:Zfp423	APN	8	87781443	missense	probably damaging	1.00
IGL03198:Zfp423	APN	8	87781676	missense	possibly damaging	0.73
IGL03383:Zfp423	APN	8	87859452	nonsense	probably null
swell	UTSW	8	87686559	splice site	probably null
Temptation	UTSW	8	87781753	missense	probably benign	0.25
trials	UTSW	8	87780713	missense	probably damaging	1.00
R0110:Zfp423	UTSW	8	87782259	missense	possibly damaging	0.60
R0142:Zfp423	UTSW	8	87780340	nonsense	probably null
R0256:Zfp423	UTSW	8	87773634	nonsense	probably null
R0538:Zfp423	UTSW	8	87782085	missense	probably damaging	0.99
R0542:Zfp423	UTSW	8	87780609	missense	probably damaging	1.00
R0614:Zfp423	UTSW	8	87782114	missense	probably damaging	1.00
R1179:Zfp423	UTSW	8	87688072	missense	probably damaging	0.97
R1417:Zfp423	UTSW	8	87773656	splice site	probably null
R1429:Zfp423	UTSW	8	87686442	missense	probably damaging	0.99
R1570:Zfp423	UTSW	8	87782558	missense	probably benign	0.37
R2013:Zfp423	UTSW	8	87782397	missense	probably benign	0.43
R2043:Zfp423	UTSW	8	87782618	missense	probably damaging	1.00
R2064:Zfp423	UTSW	8	87781358	missense	probably benign	0.04
R2108:Zfp423	UTSW	8	87781178	missense	possibly damaging	0.73
R2358:Zfp423	UTSW	8	87780551	missense	possibly damaging	0.56
R3177:Zfp423	UTSW	8	87782331	missense	probably damaging	1.00
R3277:Zfp423	UTSW	8	87782331	missense	probably damaging	1.00
R3738:Zfp423	UTSW	8	87781344	missense	probably damaging	1.00
R3739:Zfp423	UTSW	8	87781344	missense	probably damaging	1.00
R3773:Zfp423	UTSW	8	87780512	missense	probably benign	0.03
R4034:Zfp423	UTSW	8	87781344	missense	probably damaging	1.00
R4425:Zfp423	UTSW	8	87782973	missense	probably damaging	1.00
R4611:Zfp423	UTSW	8	87688081	missense	possibly damaging	0.90
R4700:Zfp423	UTSW	8	87781710	splice site	probably null
R4753:Zfp423	UTSW	8	87781446	missense	probably benign	0.00
R4818:Zfp423	UTSW	8	87904500	missense	probably benign	0.00
R5026:Zfp423	UTSW	8	87780674	missense	probably damaging	1.00
R5190:Zfp423	UTSW	8	87782463	missense	probably damaging	1.00
R5243:Zfp423	UTSW	8	87773647	missense	probably benign	0.03
R5284:Zfp423	UTSW	8	87781677	missense	possibly damaging	0.73
R5586:Zfp423	UTSW	8	87859340	missense	possibly damaging	0.93
R5601:Zfp423	UTSW	8	87782009	missense	probably damaging	1.00
R5671:Zfp423	UTSW	8	87782327	missense	probably damaging	0.99
R5717:Zfp423	UTSW	8	87686559	splice site	probably null
R5801:Zfp423	UTSW	8	87859362	missense	probably damaging	0.99
R5917:Zfp423	UTSW	8	87782232	nonsense	probably null
R5985:Zfp423	UTSW	8	87782146	missense	possibly damaging	0.83
R6111:Zfp423	UTSW	8	87782687	missense	probably damaging	0.99
R6306:Zfp423	UTSW	8	87782034	missense	possibly damaging	0.64
R6770:Zfp423	UTSW	8	87781817	missense	probably damaging	0.99
R6970:Zfp423	UTSW	8	87803779	missense	probably benign	0.00
R7029:Zfp423	UTSW	8	87688066	missense	probably damaging	0.99
R7060:Zfp423	UTSW	8	87782879	missense	probably damaging	1.00
R7074:Zfp423	UTSW	8	87782432	missense	probably benign	0.00
R7121:Zfp423	UTSW	8	87780861	missense	probably damaging	1.00
R7359:Zfp423	UTSW	8	87782243	missense	possibly damaging	0.52
R7426:Zfp423	UTSW	8	87780713	missense	probably damaging	1.00
R7540:Zfp423	UTSW	8	87688067	missense	possibly damaging	0.95
R7640:Zfp423	UTSW	8	87781277	missense	probably damaging	1.00
R7767:Zfp423	UTSW	8	87780884	missense	probably damaging	1.00
R7938:Zfp423	UTSW	8	87895676	missense	unknown
R7986:Zfp423	UTSW	8	87780350	missense	probably benign	0.04
R8347:Zfp423	UTSW	8	87783156	missense	probably damaging	0.99
R8356:Zfp423	UTSW	8	87783282	missense	probably damaging	1.00
R8676:Zfp423	UTSW	8	87782710	missense	probably benign	0.04
R8710:Zfp423	UTSW	8	87780921	missense	possibly damaging	0.74
R8794:Zfp423	UTSW	8	87781229	missense	probably damaging	1.00
R8832:Zfp423	UTSW	8	87781199	missense	probably damaging	0.98
R9018:Zfp423	UTSW	8	87781753	missense	probably benign	0.25
R9182:Zfp423	UTSW	8	87782114	missense	probably damaging	0.99
R9309:Zfp423	UTSW	8	87783060	missense	probably damaging	0.99
R9312:Zfp423	UTSW	8	87781941	missense	probably damaging	1.00
R9453:Zfp423	UTSW	8	87781623	missense	probably damaging	1.00
R9469:Zfp423	UTSW	8	87782891	missense	probably damaging	0.99
R9480:Zfp423	UTSW	8	87904487	critical splice donor site	probably null
R9483:Zfp423	UTSW	8	87781097	missense	possibly damaging	0.90
R9510:Zfp423	UTSW	8	87783413	missense	possibly damaging	0.94
R9521:Zfp423	UTSW	8	87782405	missense	probably damaging	1.00
R9606:Zfp423	UTSW	8	87687967	missense	probably damaging	0.99
R9789:Zfp423	UTSW	8	87780249	missense	probably benign	0.03
Z1176:Zfp423	UTSW	8	87859420	missense	possibly damaging	0.49
Z1177:Zfp423	UTSW	8	87780925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCATATGGAATGAGTTTTACTGGC -3'
(R):5'- AAATTTGTAGGTTTTGTGCCCC -3'

Sequencing Primer
(F):5'- GAGTTTTACTGGCCATATGGAATAG -3'
(R):5'- GACCTGTGTCTTACCCCAT -3'

Posted On

2019-06-26