Incidental Mutation 'R7242:Olfr935'
ID563296
Institutional Source Beutler Lab
Gene Symbol Olfr935
Ensembl Gene ENSMUSG00000059595
Gene Nameolfactory receptor 935
SynonymsGA_x6K02T2PVTD-32691280-32690354, MOR171-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38993971-38999683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38995141 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 98 (I98T)
Ref Sequence ENSEMBL: ENSMUSP00000149193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080748] [ENSMUST00000214157]
Predicted Effect probably benign
Transcript: ENSMUST00000080748
AA Change: I98T

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079572
Gene: ENSMUSG00000059595
AA Change: I98T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-53 PFAM
Pfam:7tm_1 41 290 1.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214157
AA Change: I98T

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Olfr935
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr935 APN 9 38995100 missense probably benign 0.08
IGL01671:Olfr935 APN 9 38994853 missense probably benign 0.05
IGL02331:Olfr935 APN 9 38995106 missense probably damaging 0.99
IGL03069:Olfr935 APN 9 38995432 start codon destroyed probably null 0.98
IGL03143:Olfr935 APN 9 38995436 utr 5 prime probably benign
R0149:Olfr935 UTSW 9 38994584 missense probably benign 0.05
R0400:Olfr935 UTSW 9 38995198 missense probably damaging 1.00
R1818:Olfr935 UTSW 9 38994606 missense possibly damaging 0.61
R2092:Olfr935 UTSW 9 38995189 missense probably damaging 1.00
R2151:Olfr935 UTSW 9 38994716 missense probably damaging 1.00
R2166:Olfr935 UTSW 9 38995217 nonsense probably null
R2347:Olfr935 UTSW 9 38994509 makesense probably null
R4404:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R4406:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R5152:Olfr935 UTSW 9 38995177 missense possibly damaging 0.88
R5467:Olfr935 UTSW 9 38994904 missense probably benign 0.14
R5509:Olfr935 UTSW 9 38994628 missense probably benign 0.03
R5954:Olfr935 UTSW 9 38995415 missense probably damaging 1.00
R6647:Olfr935 UTSW 9 38994914 missense possibly damaging 0.55
R6680:Olfr935 UTSW 9 38994658 missense probably damaging 1.00
R6928:Olfr935 UTSW 9 38994632 missense probably benign 0.03
R7271:Olfr935 UTSW 9 38994657 nonsense probably null
R7309:Olfr935 UTSW 9 38995280 missense probably damaging 1.00
R7775:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7778:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7866:Olfr935 UTSW 9 38994731 missense not run
R8280:Olfr935 UTSW 9 38994779 missense probably benign
R8334:Olfr935 UTSW 9 38994593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTTGATCACATCATATCTGCAG -3'
(R):5'- ACCTGGGCATGATCATCCTG -3'

Sequencing Primer
(F):5'- TGAGCTGATGCACAAACTATGC -3'
(R):5'- GATCATCCTGATCCTGCTCAG -3'
Posted On2019-06-26