Incidental Mutation 'R7242:Dmtn'
ID563309
Institutional Source Beutler Lab
Gene Symbol Dmtn
Ensembl Gene ENSMUSG00000022099
Gene Namedematin actin binding protein
SynonymsEpb4.9, dematin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70601263-70636048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70618020 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000022694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000226543] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228009] [ENSMUST00000228295] [ENSMUST00000228824]
Predicted Effect probably damaging
Transcript: ENSMUST00000022694
AA Change: T10A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: T10A

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 8 93 8e-30 PFAM
Pfam:AbLIM_anchor 79 347 1.9e-58 PFAM
VHP 348 383 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022695
SMART Domains Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
coiled coil region 188 220 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
VHP 345 380 1.88e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110984
AA Change: T10A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: T10A

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 213 245 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
VHP 348 383 1.88e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226543
AA Change: T10A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227331
Predicted Effect probably benign
Transcript: ENSMUST00000228001
Predicted Effect probably damaging
Transcript: ENSMUST00000228009
AA Change: T10A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228295
Predicted Effect probably benign
Transcript: ENSMUST00000228824
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Dmtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Dmtn APN 14 70604819 missense probably damaging 1.00
IGL02836:Dmtn APN 14 70616078 missense probably damaging 1.00
R1248:Dmtn UTSW 14 70612658 splice site probably benign
R2428:Dmtn UTSW 14 70613403 missense probably damaging 1.00
R3438:Dmtn UTSW 14 70612716 missense probably damaging 0.98
R4851:Dmtn UTSW 14 70604814 missense probably damaging 1.00
R4917:Dmtn UTSW 14 70605719 missense probably damaging 0.98
R4924:Dmtn UTSW 14 70617959 missense probably benign 0.25
R5633:Dmtn UTSW 14 70604979 missense probably benign 0.18
R6170:Dmtn UTSW 14 70617355 missense probably damaging 1.00
R6214:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6215:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6639:Dmtn UTSW 14 70617430 missense probably damaging 1.00
R6860:Dmtn UTSW 14 70614882 missense possibly damaging 0.94
R7139:Dmtn UTSW 14 70617427 missense probably benign 0.12
R7380:Dmtn UTSW 14 70617328 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGAGTTCACAGGACCTCC -3'
(R):5'- AACGTCTGCAGAAGGTGAGC -3'

Sequencing Primer
(F):5'- GTTCACAGGACCTCCCTCCATG -3'
(R):5'- CAGAAGGTGAGCGGCTTGC -3'
Posted On2019-06-26