Incidental Mutation 'R7242:Pcdhac2'
ID563319
Institutional Source Beutler Lab
Gene Symbol Pcdhac2
Ensembl Gene ENSMUSG00000102697
Gene Nameprotocadherin alpha subfamily C, 2
SynonymsCNRc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37143503-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37144893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 309 (I309F)
Ref Sequence ENSEMBL: ENSMUSP00000039888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007584] [ENSMUST00000047479] [ENSMUST00000047614] [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000007584
SMART Domains Protein: ENSMUSP00000007584
Gene: ENSMUSG00000103255

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 45 122 3.59e-1 SMART
CA 146 231 6.32e-22 SMART
CA 255 338 5.18e-18 SMART
CA 362 443 9.73e-23 SMART
CA 467 554 4.24e-23 SMART
CA 584 662 1.11e-8 SMART
Pfam:Cadherin_C_2 682 773 1.1e-12 PFAM
Pfam:Cadherin_tail 813 947 5.4e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047479
AA Change: I309F

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039888
Gene: ENSMUSG00000102697
AA Change: I309F

DomainStartEndE-ValueType
CA 30 145 9.8e-3 SMART
CA 169 254 2.07e-17 SMART
CA 278 362 2.86e-29 SMART
CA 386 466 4.79e-22 SMART
CA 490 576 1.44e-25 SMART
CA 606 687 3.45e-14 SMART
Pfam:Cadherin_C_2 702 809 1.2e-26 PFAM
low complexity region 810 823 N/A INTRINSIC
Pfam:Cadherin_tail 855 989 5.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047614
SMART Domains Protein: ENSMUSP00000047609
Gene: ENSMUSG00000103310

DomainStartEndE-ValueType
CA 19 131 3.78e-2 SMART
CA 155 240 3.26e-24 SMART
CA 264 348 6.37e-27 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 6.18e-25 SMART
CA 594 676 5.6e-14 SMART
low complexity region 679 696 N/A INTRINSIC
transmembrane domain 699 721 N/A INTRINSIC
Pfam:Cadherin_tail 799 933 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and fertile with no apparent gross phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Pcdhac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Pcdhac2 APN 18 37145075 missense probably damaging 1.00
IGL01400:Pcdhac2 APN 18 37146286 missense possibly damaging 0.79
IGL02302:Pcdhac2 APN 18 37145953 missense probably damaging 0.99
IGL02381:Pcdhac2 APN 18 37144267 missense possibly damaging 0.94
IGL02644:Pcdhac2 APN 18 37145179 missense probably benign
IGL02645:Pcdhac2 APN 18 37145239 missense probably damaging 0.97
IGL03087:Pcdhac2 APN 18 37145682 missense probably damaging 1.00
R0004:Pcdhac2 UTSW 18 37145237 missense probably benign 0.21
R0374:Pcdhac2 UTSW 18 37145667 missense probably damaging 1.00
R0540:Pcdhac2 UTSW 18 37145889 missense probably benign 0.02
R0589:Pcdhac2 UTSW 18 37146474 missense probably benign
R0607:Pcdhac2 UTSW 18 37145889 missense probably benign 0.02
R1537:Pcdhac2 UTSW 18 37146486 missense possibly damaging 0.51
R1545:Pcdhac2 UTSW 18 37146133 missense possibly damaging 0.93
R1878:Pcdhac2 UTSW 18 37145162 missense possibly damaging 0.71
R2139:Pcdhac2 UTSW 18 37146086 nonsense probably null
R2197:Pcdhac2 UTSW 18 37146132 missense probably damaging 0.99
R2680:Pcdhac2 UTSW 18 37145586 missense possibly damaging 0.82
R2882:Pcdhac2 UTSW 18 37145812 missense probably damaging 1.00
R3719:Pcdhac2 UTSW 18 37146235 missense possibly damaging 0.59
R4256:Pcdhac2 UTSW 18 37144711 missense probably damaging 1.00
R4407:Pcdhac2 UTSW 18 37144446 missense probably benign 0.00
R4426:Pcdhac2 UTSW 18 37144743 missense probably benign 0.00
R4698:Pcdhac2 UTSW 18 37145769 missense probably damaging 1.00
R4737:Pcdhac2 UTSW 18 37145899 missense possibly damaging 0.95
R4950:Pcdhac2 UTSW 18 37145230 missense probably benign 0.06
R4993:Pcdhac2 UTSW 18 37146251 missense probably damaging 0.96
R5127:Pcdhac2 UTSW 18 37144299 nonsense probably null
R5446:Pcdhac2 UTSW 18 37145200 missense probably damaging 1.00
R5598:Pcdhac2 UTSW 18 37144423 missense probably damaging 1.00
R5615:Pcdhac2 UTSW 18 37146423 missense probably benign 0.22
R5615:Pcdhac2 UTSW 18 37146424 missense probably benign
R5620:Pcdhac2 UTSW 18 37144204 missense probably benign
R5661:Pcdhac2 UTSW 18 37145446 missense probably damaging 0.97
R5760:Pcdhac2 UTSW 18 37146400 missense probably damaging 1.00
R6102:Pcdhac2 UTSW 18 37146282 nonsense probably null
R6310:Pcdhac2 UTSW 18 37145771 nonsense probably null
R6493:Pcdhac2 UTSW 18 37144705 missense probably damaging 1.00
R6695:Pcdhac2 UTSW 18 37145203 missense probably benign 0.00
R6827:Pcdhac2 UTSW 18 37144653 missense probably benign 0.03
R6953:Pcdhac2 UTSW 18 37144426 missense probably benign
R7140:Pcdhac2 UTSW 18 37144186 missense possibly damaging 0.89
R7162:Pcdhac2 UTSW 18 37145787 missense probably benign 0.13
R7325:Pcdhac2 UTSW 18 37145360 missense probably damaging 1.00
R7640:Pcdhac2 UTSW 18 37144525 missense probably damaging 1.00
R7654:Pcdhac2 UTSW 18 37145023 missense probably damaging 1.00
R7810:Pcdhac2 UTSW 18 37145664 missense probably benign 0.18
R8072:Pcdhac2 UTSW 18 37145664 missense probably benign 0.18
R8079:Pcdhac2 UTSW 18 37146144 missense probably damaging 0.96
R8272:Pcdhac2 UTSW 18 37146189 missense probably benign 0.30
T0970:Pcdhac2 UTSW 18 37145335 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AATGACAATTCTCCTGCCTTTGAC -3'
(R):5'- AGGGCCACAACAGTGTTGAG -3'

Sequencing Primer
(F):5'- TTGACCAATCCACTTACCGCG -3'
(R):5'- GCTGTATAAGTCTGTGAGCACCAC -3'
Posted On2019-06-26