Incidental Mutation 'R7242:Stx5a'
ID563321
Institutional Source Beutler Lab
Gene Symbol Stx5a
Ensembl Gene ENSMUSG00000010110
Gene Namesyntaxin 5A
SynonymsD19Ertd627e, 0610031F24Rik, syntaxin 5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8741413-8756069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8755277 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 437 (W437R)
Ref Sequence ENSEMBL: ENSMUSP00000010254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010241] [ENSMUST00000010254] [ENSMUST00000073430] [ENSMUST00000175872] [ENSMUST00000176013] [ENSMUST00000176381] [ENSMUST00000176968] [ENSMUST00000177322] [ENSMUST00000177373] [ENSMUST00000183939] [ENSMUST00000184756] [ENSMUST00000184970]
Predicted Effect probably benign
Transcript: ENSMUST00000010241
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect unknown
Transcript: ENSMUST00000010254
AA Change: W437R
SMART Domains Protein: ENSMUSP00000010254
Gene: ENSMUSG00000010110
AA Change: W437R

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin-5_N 52 74 1.5e-15 PFAM
SCOP:d1fioa_ 92 298 7e-36 SMART
Blast:t_SNARE 258 304 9e-22 BLAST
low complexity region 346 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073430
SMART Domains Protein: ENSMUSP00000073136
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175872
SMART Domains Protein: ENSMUSP00000135416
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176013
SMART Domains Protein: ENSMUSP00000135465
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 143 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176381
SMART Domains Protein: ENSMUSP00000134854
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176968
SMART Domains Protein: ENSMUSP00000135468
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
t_SNARE 12 79 4.33e-15 SMART
transmembrane domain 88 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177322
SMART Domains Protein: ENSMUSP00000135624
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177373
SMART Domains Protein: ENSMUSP00000134794
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
Pfam:Syntaxin 1 98 5.2e-15 PFAM
t_SNARE 162 229 4.33e-15 SMART
transmembrane domain 238 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183939
SMART Domains Protein: ENSMUSP00000139351
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
Pfam:Tap-RNA_bind 1 63 5.7e-28 PFAM
low complexity region 122 138 N/A INTRINSIC
Pfam:LRR_1 155 178 2.1e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184756
SMART Domains Protein: ENSMUSP00000139050
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184970
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Hsd3b1 T C 3: 98,853,210 Y155C probably damaging Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Stx5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03152:Stx5a APN 19 8749774 critical splice donor site probably null
R0541:Stx5a UTSW 19 8749937 missense probably damaging 1.00
R0726:Stx5a UTSW 19 8754911 missense probably damaging 1.00
R1566:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R1990:Stx5a UTSW 19 8748890 critical splice donor site probably null
R2852:Stx5a UTSW 19 8755112 unclassified probably benign
R3022:Stx5a UTSW 19 8755154 unclassified probably benign
R4426:Stx5a UTSW 19 8749740 missense probably benign 0.02
R4684:Stx5a UTSW 19 8743361 missense probably damaging 0.96
R5594:Stx5a UTSW 19 8748465 missense probably damaging 1.00
R5750:Stx5a UTSW 19 8755137 unclassified probably benign
R5929:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R6644:Stx5a UTSW 19 8755248 unclassified probably benign
R6983:Stx5a UTSW 19 8755169 unclassified probably benign
R7258:Stx5a UTSW 19 8754907 critical splice acceptor site probably null
R7464:Stx5a UTSW 19 8743504 unclassified probably benign
R7871:Stx5a UTSW 19 8755118 missense unknown
R7880:Stx5a UTSW 19 8742328 missense probably damaging 1.00
R7980:Stx5a UTSW 19 8742438 missense probably damaging 1.00
R8375:Stx5a UTSW 19 8755098 missense unknown
X0020:Stx5a UTSW 19 8748890 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCATTCTGAGCCACTCCATG -3'
(R):5'- GACCCAGATGATGAAGTTGGTC -3'

Sequencing Primer
(F):5'- ACTCCATGGAGGGCTTGG -3'
(R):5'- CCAGATGATGAAGTTGGTCCCTTG -3'
Posted On2019-06-26