Incidental Mutation 'R7243:Ptprj'
ID563333
Institutional Source Beutler Lab
Gene Symbol Ptprj
Ensembl Gene ENSMUSG00000025314
Gene Nameprotein tyrosine phosphatase, receptor type, J
SynonymsCD148, Byp, Scc1, Scc-1, DEP-1, RPTPJ
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R7243 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90429754-90580647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90446421 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1102 (H1102R)
Ref Sequence ENSEMBL: ENSMUSP00000129592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111493] [ENSMUST00000111495] [ENSMUST00000168621]
Predicted Effect probably damaging
Transcript: ENSMUST00000111493
AA Change: H916R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107119
Gene: ENSMUSG00000025314
AA Change: H916R

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
FN3 47 182 3.76e-6 SMART
FN3 194 271 4.56e-5 SMART
FN3 282 357 5.32e-6 SMART
FN3 368 446 2.19e-7 SMART
FN3 455 531 5e-2 SMART
FN3 546 628 2.77e1 SMART
low complexity region 637 650 N/A INTRINSIC
Blast:PTPc 714 797 8e-26 BLAST
PTPc 867 1127 3.37e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111495
AA Change: H1009R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107121
Gene: ENSMUSG00000025314
AA Change: H1009R

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
FN3 59 131 2.85e-6 SMART
FN3 140 275 3.76e-6 SMART
FN3 287 364 4.56e-5 SMART
FN3 375 450 5.32e-6 SMART
FN3 461 539 2.19e-7 SMART
FN3 548 624 5e-2 SMART
FN3 639 721 2.77e1 SMART
low complexity region 730 743 N/A INTRINSIC
Blast:PTPc 807 890 1e-25 BLAST
PTPc 960 1220 3.37e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168621
AA Change: H1102R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314
AA Change: H1102R

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 26 94 N/A INTRINSIC
low complexity region 133 140 N/A INTRINSIC
FN3 152 224 2.85e-6 SMART
FN3 233 368 3.76e-6 SMART
FN3 380 457 4.56e-5 SMART
FN3 468 543 5.32e-6 SMART
FN3 554 632 2.19e-7 SMART
FN3 641 717 5e-2 SMART
FN3 732 814 2.77e1 SMART
low complexity region 823 836 N/A INTRINSIC
Blast:PTPc 900 983 1e-25 BLAST
PTPc 1053 1313 3.37e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Aox3 G T 1: 58,138,307 G227V unknown Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Grin2d A G 7: 45,866,128 L147P probably damaging Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Lrba T A 3: 86,751,516 probably null Het
Lrig2 A T 3: 104,497,567 probably null Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Odc1 T G 12: 17,550,057 Y407* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr561 A T 7: 102,781,658 T61S probably benign Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Rbfox3 T C 11: 118,513,274 Y33C probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Rpgrip1l T C 8: 91,270,123 I710V probably benign Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Ptprj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Ptprj APN 2 90452144 missense probably damaging 1.00
IGL01594:Ptprj APN 2 90440795 splice site probably benign
IGL01767:Ptprj APN 2 90469574 missense probably benign 0.11
IGL01917:Ptprj APN 2 90469749 missense probably damaging 1.00
IGL01981:Ptprj APN 2 90439912 missense probably damaging 1.00
IGL02830:Ptprj APN 2 90453144 missense probably benign 0.22
IGL02955:Ptprj APN 2 90468464 critical splice acceptor site probably null
IGL03102:Ptprj APN 2 90478968 missense probably benign 0.02
IGL03150:Ptprj APN 2 90460611 missense probably damaging 0.98
IGL03210:Ptprj APN 2 90469726 missense probably benign 0.01
IGL02799:Ptprj UTSW 2 90469598 missense probably benign 0.00
R0083:Ptprj UTSW 2 90469777 intron probably null
R0108:Ptprj UTSW 2 90469777 intron probably null
R0579:Ptprj UTSW 2 90436569 critical splice acceptor site probably null
R1130:Ptprj UTSW 2 90453421 missense probably damaging 1.00
R1160:Ptprj UTSW 2 90444524 missense probably damaging 1.00
R1238:Ptprj UTSW 2 90444414 splice site probably null
R1507:Ptprj UTSW 2 90471287 missense possibly damaging 0.87
R1552:Ptprj UTSW 2 90471153 missense probably damaging 0.98
R1607:Ptprj UTSW 2 90463320 missense probably benign 0.14
R1693:Ptprj UTSW 2 90449797 nonsense probably null
R2016:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2017:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2044:Ptprj UTSW 2 90463095 missense probably damaging 0.96
R2322:Ptprj UTSW 2 90471129 missense probably benign 0.06
R2516:Ptprj UTSW 2 90474996 splice site probably benign
R3106:Ptprj UTSW 2 90440631 missense probably damaging 1.00
R3964:Ptprj UTSW 2 90468441 missense probably benign 0.00
R4201:Ptprj UTSW 2 90463095 missense probably damaging 0.99
R4533:Ptprj UTSW 2 90439955 missense probably damaging 1.00
R4680:Ptprj UTSW 2 90460496 missense probably benign 0.00
R4738:Ptprj UTSW 2 90440643 missense probably damaging 1.00
R4983:Ptprj UTSW 2 90460532 missense probably damaging 0.98
R5137:Ptprj UTSW 2 90469648 missense possibly damaging 0.70
R5349:Ptprj UTSW 2 90471261 missense probably benign 0.00
R5369:Ptprj UTSW 2 90469641 missense probably benign 0.09
R5718:Ptprj UTSW 2 90458269 missense probably benign 0.00
R5914:Ptprj UTSW 2 90453340 missense possibly damaging 0.81
R6022:Ptprj UTSW 2 90471323 missense probably benign 0.14
R6341:Ptprj UTSW 2 90458349 missense probably benign
R6421:Ptprj UTSW 2 90471140 missense possibly damaging 0.62
R6724:Ptprj UTSW 2 90450851 missense probably benign 0.04
R6831:Ptprj UTSW 2 90460647 missense probably damaging 1.00
R6939:Ptprj UTSW 2 90459514 missense possibly damaging 0.68
R6972:Ptprj UTSW 2 90580403 missense possibly damaging 0.91
R7134:Ptprj UTSW 2 90464478 missense probably benign 0.16
R7149:Ptprj UTSW 2 90444446 missense possibly damaging 0.95
R7335:Ptprj UTSW 2 90440782 missense probably benign 0.01
R7439:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7441:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7498:Ptprj UTSW 2 90436565 nonsense probably null
R7571:Ptprj UTSW 2 90455186 missense probably benign 0.24
R7657:Ptprj UTSW 2 90452157 splice site probably null
R7672:Ptprj UTSW 2 90460596 missense possibly damaging 0.49
R7849:Ptprj UTSW 2 90444460 missense probably damaging 0.98
R7932:Ptprj UTSW 2 90444460 missense probably damaging 0.98
RF013:Ptprj UTSW 2 90471170 nonsense probably null
Z1177:Ptprj UTSW 2 90460569 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGGTCCTTGTGTGGCAATG -3'
(R):5'- AAAGGCTGTTGTGCATTTTCTC -3'

Sequencing Primer
(F):5'- GAAATCTTTCTTGGAATGGTAGCCC -3'
(R):5'- TGTCATAGCCTATCCACAGGG -3'
Posted On2019-06-26