Incidental Mutation 'R7243:Grin2d'
ID563355
Institutional Source Beutler Lab
Gene Symbol Grin2d
Ensembl Gene ENSMUSG00000002771
Gene Nameglutamate receptor, ionotropic, NMDA2D (epsilon 4)
SynonymsNR2D, GluRepsilon4, NMDAR2D, GluN2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R7243 (G1)
Quality Score87.0076
Status Validated
Chromosome7
Chromosomal Location45831883-45878378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45866128 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 147 (L147P)
Ref Sequence ENSEMBL: ENSMUSP00000002848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002848] [ENSMUST00000211250] [ENSMUST00000211713]
Predicted Effect probably damaging
Transcript: ENSMUST00000002848
AA Change: L147P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002848
Gene: ENSMUSG00000002771
AA Change: L147P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
Pfam:ANF_receptor 89 330 1.7e-12 PFAM
PBPe 428 823 4.11e-65 SMART
Lig_chan-Glu_bd 471 527 7.88e-18 SMART
transmembrane domain 843 862 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 932 943 N/A INTRINSIC
low complexity region 969 1001 N/A INTRINSIC
low complexity region 1011 1039 N/A INTRINSIC
low complexity region 1065 1091 N/A INTRINSIC
low complexity region 1095 1120 N/A INTRINSIC
low complexity region 1192 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211250
Predicted Effect probably damaging
Transcript: ENSMUST00000211713
AA Change: L147P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced spontaneous activity and an elevated auditory brainstem response threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Aox3 G T 1: 58,138,307 G227V unknown Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Lrba T A 3: 86,751,516 probably null Het
Lrig2 A T 3: 104,497,567 probably null Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Odc1 T G 12: 17,550,057 Y407* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr561 A T 7: 102,781,658 T61S probably benign Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Ptprj T C 2: 90,446,421 H1102R probably damaging Het
Rbfox3 T C 11: 118,513,274 Y33C probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Rpgrip1l T C 8: 91,270,123 I710V probably benign Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Grin2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Grin2d APN 7 45853292 missense probably damaging 0.99
IGL01772:Grin2d APN 7 45858466 missense probably benign 0.00
IGL01952:Grin2d APN 7 45862280 missense probably benign 0.23
IGL01994:Grin2d APN 7 45857972 missense probably damaging 1.00
IGL02161:Grin2d APN 7 45854422 missense possibly damaging 0.82
IGL03180:Grin2d APN 7 45853329 missense probably damaging 1.00
R1121:Grin2d UTSW 7 45854347 missense probably damaging 1.00
R1934:Grin2d UTSW 7 45856827 missense probably damaging 1.00
R2915:Grin2d UTSW 7 45833357 unclassified probably benign
R4162:Grin2d UTSW 7 45857618 missense probably damaging 0.98
R4753:Grin2d UTSW 7 45833906 missense probably damaging 0.98
R4781:Grin2d UTSW 7 45862481 missense probably damaging 1.00
R4785:Grin2d UTSW 7 45856781 missense probably damaging 0.96
R4820:Grin2d UTSW 7 45857939 missense probably damaging 1.00
R4877:Grin2d UTSW 7 45854615 missense probably damaging 1.00
R4979:Grin2d UTSW 7 45857933 missense probably benign 0.03
R5092:Grin2d UTSW 7 45854268 missense probably damaging 1.00
R6364:Grin2d UTSW 7 45858454 missense possibly damaging 0.54
R6565:Grin2d UTSW 7 45834755 missense probably damaging 1.00
R6747:Grin2d UTSW 7 45862268 missense probably damaging 0.99
R6816:Grin2d UTSW 7 45833682 unclassified probably benign
R7072:Grin2d UTSW 7 45857498 missense probably damaging 1.00
R7237:Grin2d UTSW 7 45866176 nonsense probably null
R7385:Grin2d UTSW 7 45857536 missense probably damaging 1.00
R7577:Grin2d UTSW 7 45862379 missense probably benign 0.01
R8100:Grin2d UTSW 7 45833747 missense unknown
Z1177:Grin2d UTSW 7 45833177 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGGTCTTTCCCTTCAGCC -3'
(R):5'- CGCTAAGATGCTGTTGCTG -3'

Sequencing Primer
(F):5'- TCCCTTCAGCCTACGCAGG -3'
(R):5'- AACGTGGCGCTGGTCTTC -3'
Posted On2019-06-26