Incidental Mutation 'R7243:Rpgrip1l'
ID563364
Institutional Source Beutler Lab
Gene Symbol Rpgrip1l
Ensembl Gene ENSMUSG00000033282
Gene NameRpgrip1-like
SynonymsNphp8, fantom, Ftm, 1700047E16Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7243 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location91217030-91313262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91270123 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 710 (I710V)
Ref Sequence ENSEMBL: ENSMUSP00000042702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113] [ENSMUST00000209616]
Predicted Effect probably benign
Transcript: ENSMUST00000047783
AA Change: I710V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: I710V

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
coiled coil region 196 268 N/A INTRINSIC
coiled coil region 299 371 N/A INTRINSIC
coiled coil region 395 454 N/A INTRINSIC
coiled coil region 520 556 N/A INTRINSIC
Pfam:C2-C2_1 597 738 5.8e-61 PFAM
low complexity region 769 778 N/A INTRINSIC
C2 791 896 1.06e-5 SMART
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1057 1080 N/A INTRINSIC
Blast:C2 1098 1223 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139113
SMART Domains Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209616
AA Change: I108V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (73/74)
MGI Phenotype Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,343,673 Y16C probably damaging Het
Acap1 G A 11: 69,890,471 H103Y probably benign Het
Adamdec1 A G 14: 68,571,754 M253T probably benign Het
Alox15 C A 11: 70,350,714 G114C probably null Het
Aox3 G T 1: 58,138,307 G227V unknown Het
Atp8a2 A T 14: 59,647,842 N1144K probably benign Het
Cacna1c C T 6: 118,637,729 probably null Het
Cog6 A T 3: 53,002,315 W314R probably damaging Het
Col5a2 A G 1: 45,376,160 I1473T probably benign Het
Csmd1 T A 8: 15,915,357 D3218V probably damaging Het
Cyp3a11 A G 5: 145,858,803 M446T probably damaging Het
Dhps A G 8: 85,074,938 Y340C probably benign Het
Dnah7b A G 1: 46,083,754 N108S probably benign Het
Dnajb1 C T 8: 83,610,764 P323L probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 G T 9: 7,102,405 T2665K possibly damaging Het
Etv1 C T 12: 38,857,046 S349L probably benign Het
Fam171a1 A T 2: 3,118,616 T21S probably benign Het
Fbxo18 T A 2: 11,751,525 T749S probably benign Het
Fcho2 T C 13: 98,755,216 D346G possibly damaging Het
Fcrl5 A G 3: 87,442,245 H109R probably benign Het
Fstl1 A G 16: 37,826,726 S153G probably benign Het
Fyb T C 15: 6,643,699 F605L probably benign Het
Gcat T A 15: 79,036,863 M363K possibly damaging Het
Gm10604 T C 4: 11,980,113 T64A unknown Het
Grin2d A G 7: 45,866,128 L147P probably damaging Het
Ift88 A T 14: 57,430,536 probably null Het
Ighg1 A T 12: 113,330,446 C26S Het
Ing2 A G 8: 47,674,539 S48P probably damaging Het
Kat6a C T 8: 22,938,775 T1382I probably benign Het
Kdm1a A G 4: 136,551,954 V765A probably damaging Het
Klk1b26 T C 7: 44,016,267 S168P not run Het
Klk1b26 A G 7: 44,016,913 N260S probably damaging Het
Lama3 G A 18: 12,419,845 G438D probably damaging Het
Larp6 T A 9: 60,713,286 D27E probably benign Het
Lrba T A 3: 86,751,516 probably null Het
Lrig2 A T 3: 104,497,567 probably null Het
Megf9 T C 4: 70,435,471 E366G probably benign Het
Mob1b T A 5: 88,743,445 D52E probably damaging Het
Ndufb3 A T 1: 58,591,123 H11L unknown Het
Odc1 T G 12: 17,550,057 Y407* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr328 T C 11: 58,551,401 I279M probably damaging Het
Olfr401 T A 11: 74,121,733 V148E probably damaging Het
Olfr561 A T 7: 102,781,658 T61S probably benign Het
Olfr642 A G 7: 104,049,755 Y200H probably damaging Het
Opa1 A G 16: 29,586,996 I126M probably benign Het
Pcca A G 14: 122,876,774 H633R probably benign Het
Pcdhb22 A G 18: 37,520,632 R461G probably benign Het
Pcf11 A T 7: 92,660,060 D647E probably damaging Het
Plxnd1 T A 6: 115,972,507 I773F probably benign Het
Prl8a1 A T 13: 27,582,103 L3Q probably damaging Het
Psg17 C A 7: 18,818,715 G212C probably damaging Het
Ptbp2 G T 3: 119,753,112 N40K possibly damaging Het
Ptprj T C 2: 90,446,421 H1102R probably damaging Het
Rbfox3 T C 11: 118,513,274 Y33C probably damaging Het
Ros1 T A 10: 52,123,381 N1158Y probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Slc12a4 A T 8: 105,953,920 M190K probably damaging Het
Slc22a20 G A 19: 5,971,571 R468C probably damaging Het
Slc45a2 T A 15: 11,023,350 Y347N possibly damaging Het
Slc4a10 A G 2: 62,303,862 Y974C probably damaging Het
Snap47 A G 11: 59,428,722 S197P probably benign Het
Snph T C 2: 151,594,253 S252G probably damaging Het
Spns2 A T 11: 72,456,860 W335R probably damaging Het
Thnsl1 A G 2: 21,212,847 I471V probably damaging Het
Tmprss11f C A 5: 86,530,116 G265C probably damaging Het
Tnn C T 1: 160,107,117 R1242H probably benign Het
Tsc2 T C 17: 24,599,630 R1412G probably benign Het
Tsc22d2 G T 3: 58,416,463 V259F unknown Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wls A T 3: 159,909,765 I306F possibly damaging Het
Zfp566 A G 7: 30,078,276 V160A probably benign Het
Zfyve28 T C 5: 34,198,875 T761A probably damaging Het
Zswim8 G A 14: 20,714,368 R602Q probably damaging Het
Other mutations in Rpgrip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rpgrip1l APN 8 91263574 missense possibly damaging 0.52
IGL00932:Rpgrip1l APN 8 91275637 missense probably benign 0.33
IGL01113:Rpgrip1l APN 8 91260739 intron probably benign
IGL01151:Rpgrip1l APN 8 91275149 missense probably damaging 1.00
IGL01321:Rpgrip1l APN 8 91260873 nonsense probably null
IGL01384:Rpgrip1l APN 8 91273640 missense probably benign 0.00
IGL01634:Rpgrip1l APN 8 91252543 missense probably benign
IGL01634:Rpgrip1l APN 8 91252544 missense probably benign 0.25
IGL01781:Rpgrip1l APN 8 91270218 missense probably benign 0.16
IGL01784:Rpgrip1l APN 8 91270461 missense possibly damaging 0.56
IGL02034:Rpgrip1l APN 8 91251148 critical splice donor site probably null
IGL02250:Rpgrip1l APN 8 91232861 missense probably benign 0.00
IGL02285:Rpgrip1l APN 8 91232907 missense possibly damaging 0.92
IGL02634:Rpgrip1l APN 8 91225344 splice site probably benign
IGL02736:Rpgrip1l APN 8 91263591 missense possibly damaging 0.91
IGL02825:Rpgrip1l APN 8 91304805 missense probably damaging 0.99
IGL02962:Rpgrip1l APN 8 91270362 missense possibly damaging 0.95
IGL03031:Rpgrip1l APN 8 91260783 missense probably damaging 1.00
IGL03184:Rpgrip1l APN 8 91300809 missense probably damaging 1.00
P0005:Rpgrip1l UTSW 8 91299225 splice site probably benign
R0118:Rpgrip1l UTSW 8 91270122 missense probably damaging 1.00
R0490:Rpgrip1l UTSW 8 91299845 splice site probably benign
R0599:Rpgrip1l UTSW 8 91305000 missense probably damaging 1.00
R1514:Rpgrip1l UTSW 8 91260750 missense probably damaging 1.00
R1648:Rpgrip1l UTSW 8 91252889 missense probably damaging 1.00
R1914:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R1915:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R2093:Rpgrip1l UTSW 8 91270132 missense possibly damaging 0.87
R2225:Rpgrip1l UTSW 8 91221467 missense probably benign 0.45
R2504:Rpgrip1l UTSW 8 91280716 critical splice donor site probably null
R3859:Rpgrip1l UTSW 8 91263658 missense probably benign 0.00
R4118:Rpgrip1l UTSW 8 91252907 missense probably benign
R4801:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4802:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4921:Rpgrip1l UTSW 8 91261009 missense probably benign 0.05
R4976:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5092:Rpgrip1l UTSW 8 91221384 nonsense probably null
R5099:Rpgrip1l UTSW 8 91248722 missense probably benign 0.20
R5119:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5141:Rpgrip1l UTSW 8 91260918 missense probably benign 0.29
R5793:Rpgrip1l UTSW 8 91260772 missense probably benign 0.06
R5847:Rpgrip1l UTSW 8 91304985 missense probably damaging 1.00
R5871:Rpgrip1l UTSW 8 91221386 missense possibly damaging 0.89
R5916:Rpgrip1l UTSW 8 91252913 missense possibly damaging 0.93
R6619:Rpgrip1l UTSW 8 91232871 missense possibly damaging 0.69
R6654:Rpgrip1l UTSW 8 91220205 missense probably benign 0.36
R6956:Rpgrip1l UTSW 8 91286313 splice site probably null
R6984:Rpgrip1l UTSW 8 91260798 missense probably benign 0.03
R7064:Rpgrip1l UTSW 8 91263520 nonsense probably null
R7145:Rpgrip1l UTSW 8 91232806 critical splice donor site probably null
R7673:Rpgrip1l UTSW 8 91300787 missense possibly damaging 0.89
R7796:Rpgrip1l UTSW 8 91270237 missense probably damaging 1.00
Z1088:Rpgrip1l UTSW 8 91220179 makesense probably null
Z1088:Rpgrip1l UTSW 8 91260975 missense possibly damaging 0.96
Z1088:Rpgrip1l UTSW 8 91270120 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTGCACCATCATTCATGACAC -3'
(R):5'- GAACTGCAGACTACTCCCATAGTG -3'

Sequencing Primer
(F):5'- CACTAAAGAGAGTTCAGTCACTTGTG -3'
(R):5'- GAGGCCTTTACCCGGAGTATAAC -3'
Posted On2019-06-26